EMAIL THIS PAGE TO A FRIEND

CLEC3A

C-type lectin domain family 3, member A

110 Gene Product Result for
Synonyms: CLECSF1
UniProtKB ID: O75596, B2R8C4, Q3SX91, Q6UXF5
Gene ID:
Mouse(403395) C-type lectin domain family 3, member a
Rat(365009) C-type lectin domain family 3, member A
chicken(425961) C-type lectin domain family 3, member A
domestic cat(101099346) C-type lectin domain family 3, member A
cow(282415) C-type lectin domain family 3, member A
dog(610142) C-type lectin domain family 3, member A
naked mole-rat(101699298) C-type lectin domain family 3, member A
domestic guinea pig(100723141) C-type lectin domain family 3, member A
sheep(101120184) C-type lectin domain family 3, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005752 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155281 MISSION® esiRNA esiRNA human CLEC3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005752 Rosetta Predictions human pricing
NM_001108899 Rosetta Predictions rat pricing
NM_001007223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014523 predicted 494
2 SASI_Hs02_00340218 predicted 694
3 SASI_Hs01_00014526 predicted 690
4 SASI_Hs01_00014527 predicted 777
5 SASI_Hs01_00014529 predicted 821
6 SASI_Hs02_00340219 predicted 684
7 SASI_Hs02_00340220 predicted 983
8 SASI_Hs02_00340221 predicted 290
9 SASI_Hs02_00340222 predicted 981
10 SASI_Hs02_00340223 predicted 309
11 SASI_Hs01_00014524 predicted 504
12 SASI_Hs01_00014525 predicted 678
13 SASI_Hs01_00014528 predicted 999
14 SASI_Hs01_00014530 predicted 605
15 SASI_Hs01_00014531 predicted 444
16 SASI_Hs01_00014532 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243185 predicted 278
2 SASI_Rn02_00243186 predicted 212
3 SASI_Rn02_00243187 predicted 351
4 SASI_Rn02_00243188 predicted 328
5 SASI_Rn02_00243189 predicted 201
6 SASI_Rn02_00243190 predicted 211
7 SASI_Rn02_00243191 predicted 312
8 SASI_Rn02_00243192 predicted 331
9 SASI_Rn02_00243193 predicted 266
10 SASI_Rn02_00243194 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057993 predicted 331
2 SASI_Mm01_00057994 predicted 358
3 SASI_Mm01_00057995 predicted 202
4 SASI_Mm01_00057996 predicted 209
5 SASI_Mm01_00057997 predicted 334
6 SASI_Mm01_00057998 predicted 223
7 SASI_Mm01_00057999 predicted 276
8 SASI_Mm01_00058001 predicted 201
9 SASI_Mm01_00058002 predicted 212
10 SASI_Mm02_00286727 predicted 203
11 SASI_Mm01_00058000 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005752
CLEC3A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 3, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-291s1c1
Sequence:CCGGGCACTAAAGTTCACAAGAAATCTCGAGATTTCTTGTGAACTTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-188s1c1
Sequence:CCGGGTGAGAGACAAGGATGGAGATCTCGAGATCTCCATCCTTGTCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-286s1c1
Sequence:CCGGGCGAGGCACTAAAGTTCACAACTCGAGTTGTGAACTTTAGTGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-312s1c1
Sequence:CCGGGCTACCTTGCTTCAGAAGGTTCTCGAGAACCTTCTGAAGCAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-416s1c1
Sequence:CCGGGCCCTCCAAGACTATGGTAAACTCGAGTTTACCATAGTCTTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005752
CLEC3A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 3, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-291s1c1
Sequence:CCGGGCACTAAAGTTCACAAGAAATCTCGAGATTTCTTGTGAACTTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-188s1c1
Sequence:CCGGGTGAGAGACAAGGATGGAGATCTCGAGATCTCCATCCTTGTCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-286s1c1
Sequence:CCGGGCGAGGCACTAAAGTTCACAACTCGAGTTGTGAACTTTAGTGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-312s1c1
Sequence:CCGGGCTACCTTGCTTCAGAAGGTTCTCGAGAACCTTCTGAAGCAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-416s1c1
Sequence:CCGGGCCCTCCAAGACTATGGTAAACTCGAGTTTACCATAGTCTTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005752
CLEC3A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 3, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-291s1c1
Sequence:CCGGGCACTAAAGTTCACAAGAAATCTCGAGATTTCTTGTGAACTTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-188s1c1
Sequence:CCGGGTGAGAGACAAGGATGGAGATCTCGAGATCTCCATCCTTGTCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-286s1c1
Sequence:CCGGGCGAGGCACTAAAGTTCACAACTCGAGTTGTGAACTTTAGTGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-312s1c1
Sequence:CCGGGCTACCTTGCTTCAGAAGGTTCTCGAGAACCTTCTGAAGCAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005752.1-416s1c1
Sequence:CCGGGCCCTCCAAGACTATGGTAAACTCGAGTTTACCATAGTCTTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007223
CLEC3A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 3, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-220s1c1
Sequence:CCGGGTTCATAAGAAGTGCTACCTTCTCGAGAAGGTAGCACTTCTTATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-156s1c1
Sequence:CCGGGCGGGAAGTCAACGCCTTGAACTCGAGTTCAAGGCGTTGACTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-273s1c1
Sequence:CCGGCAACGAAGACTGCATTTCCAACTCGAGTTGGAAATGCAGTCTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-387s1c1
Sequence:CCGGGCTAGGCATAAATGACATGGTCTCGAGACCATGTCATTTATGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-322s1c1
Sequence:CCGGTCCGACGAAATCAATGCCCTTCTCGAGAAGGGCATTGATTTCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007223
CLEC3A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 3, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-220s1c1
Sequence:CCGGGTTCATAAGAAGTGCTACCTTCTCGAGAAGGTAGCACTTCTTATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-156s1c1
Sequence:CCGGGCGGGAAGTCAACGCCTTGAACTCGAGTTCAAGGCGTTGACTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-273s1c1
Sequence:CCGGCAACGAAGACTGCATTTCCAACTCGAGTTGGAAATGCAGTCTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-387s1c1
Sequence:CCGGGCTAGGCATAAATGACATGGTCTCGAGACCATGTCATTTATGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-322s1c1
Sequence:CCGGTCCGACGAAATCAATGCCCTTCTCGAGAAGGGCATTGATTTCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007223
CLEC3A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 3, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-220s1c1
Sequence:CCGGGTTCATAAGAAGTGCTACCTTCTCGAGAAGGTAGCACTTCTTATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-156s1c1
Sequence:CCGGGCGGGAAGTCAACGCCTTGAACTCGAGTTCAAGGCGTTGACTTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-273s1c1
Sequence:CCGGCAACGAAGACTGCATTTCCAACTCGAGTTGGAAATGCAGTCTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-387s1c1
Sequence:CCGGGCTAGGCATAAATGACATGGTCTCGAGACCATGTCATTTATGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007223.1-322s1c1
Sequence:CCGGTCCGACGAAATCAATGCCCTTCTCGAGAAGGGCATTGATTTCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks