EMAIL THIS PAGE TO A FRIEND

CLEC3B

C-type lectin domain family 3, member B

47 Gene Product Result for
Synonyms: TN TNA
UniProtKB ID: P05452, Q6FGX6
Gene ID:
Mouse(21922) C-type lectin domain family 3, member b
Rat(316099) C-type lectin domain family 3, member B
sheep(101120024) C-type lectin domain family 3, member B
domestic guinea pig(100713969) C-type lectin domain family 3, member B
naked mole-rat(101701397) C-type lectin domain family 3, member B
chicken(395386) C-type lectin domain family 3, member B
domestic cat(101082218) C-type lectin domain family 3, member B
cow(515783) C-type lectin domain family 3, member B
dog(609596) C-type lectin domain family 3, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1375 Human CLEC3B ELISA for serum, plasma and cell culture supernatants human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0552 AQUA Peptide EQQALQTV(CM-Cys)L[K] human pricing
AQ0551 AQUA Peptide LDTLAQEVALL[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003278 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001811 MISSION® esiRNA esiRNA targeting human CLEC3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003278 Rosetta Predictions human pricing
XM_236746 Rosetta Predictions rat pricing
NM_011606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045988 predicted 289
2 SASI_Hs01_00045989 predicted 316
3 SASI_Hs01_00045990 predicted 432
4 SASI_Hs01_00045991 predicted 476
5 SASI_Hs01_00045992 predicted 482
6 SASI_Hs01_00045993 predicted 417
7 SASI_Hs01_00045994 predicted 423
8 SASI_Hs01_00045995 predicted 310
9 SASI_Hs01_00045996 predicted 340
10 SASI_Hs01_00045997 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130909 predicted 325
2 SASI_Rn01_00130910 predicted 215
3 SASI_Rn01_00130911 predicted 279
4 SASI_Rn01_00130912 predicted 223
5 SASI_Rn01_00130913 predicted 385
6 SASI_Rn01_00130914 predicted 201
7 SASI_Rn01_00130915 predicted 323
8 SASI_Rn01_00130916 predicted 388
9 SASI_Rn01_00130917 predicted 275
10 SASI_Rn01_00130918 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112214 predicted 196
2 SASI_Mm01_00112215 predicted 283
3 SASI_Mm01_00112216 predicted 311
4 SASI_Mm01_00112217 predicted 204
5 SASI_Mm02_00321030 predicted 214
6 SASI_Mm01_00112218 predicted 286
7 SASI_Mm01_00112219 predicted 274
8 SASI_Mm01_00112220 predicted 421
9 SASI_Mm02_00321031 predicted 210
10 SASI_Mm02_00321032 predicted 211
11 SASI_Mm01_00112221 predicted 461
12 SASI_Mm01_00112222 predicted 525
13 SASI_Mm01_00112223 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011606
CLEC3B MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 3, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011606.1-869s1c1
Sequence:CCGGCACAAAGAGCAGAAGGCTGTTCTCGAGAACAGCCTTCTGCTCTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-762s1c1
Sequence:CCGGCCGCGATCAGTTGCCCTACATCTCGAGATGTAGGGCAACTGATCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-393s1c1
Sequence:CCGGCTTACAGACTGTGTGCCTGAACTCGAGTTCAGGCACACAGTCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-286s1c1
Sequence:CCGGGCTGCAAATGCCAAGAAAGATCTCGAGATCTTTCTTGGCATTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-333s1c1
Sequence:CCGGGCTCAAGAACAGGATGGATGTCTCGAGACATCCATCCTGTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011606
CLEC3B MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 3, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011606.1-869s1c1
Sequence:CCGGCACAAAGAGCAGAAGGCTGTTCTCGAGAACAGCCTTCTGCTCTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-762s1c1
Sequence:CCGGCCGCGATCAGTTGCCCTACATCTCGAGATGTAGGGCAACTGATCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-393s1c1
Sequence:CCGGCTTACAGACTGTGTGCCTGAACTCGAGTTCAGGCACACAGTCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-286s1c1
Sequence:CCGGGCTGCAAATGCCAAGAAAGATCTCGAGATCTTTCTTGGCATTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-333s1c1
Sequence:CCGGGCTCAAGAACAGGATGGATGTCTCGAGACATCCATCCTGTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011606
CLEC3B MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 3, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011606.1-869s1c1
Sequence:CCGGCACAAAGAGCAGAAGGCTGTTCTCGAGAACAGCCTTCTGCTCTTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-762s1c1
Sequence:CCGGCCGCGATCAGTTGCCCTACATCTCGAGATGTAGGGCAACTGATCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-393s1c1
Sequence:CCGGCTTACAGACTGTGTGCCTGAACTCGAGTTCAGGCACACAGTCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-286s1c1
Sequence:CCGGGCTGCAAATGCCAAGAAAGATCTCGAGATCTTTCTTGGCATTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011606.1-333s1c1
Sequence:CCGGGCTCAAGAACAGGATGGATGTCTCGAGACATCCATCCTGTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003278
CLEC3B MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 3, member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-169s1c1
Sequence:CCGGCAGAAGCCCAAGAAGATTGTACTCGAGTACAATCTTCTTGGGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-318s1c1
Sequence:CCGGCAAGGTGCACATGAAATGCTTCTCGAGAAGCATTTCATGTGCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-550s1c1
Sequence:CCGGGCCTACAAGAACTGGGAGACTCTCGAGAGTCTCCCAGTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-201s1c1
Sequence:CCGGAGATGTTGTGAACACAAAGATCTCGAGATCTTTGTGTTCACAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003278.2-221s21c1
Sequence:CCGGAGATGTTTGAGGAGCTCAAGACTCGAGTCTTGAGCTCCTCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003278.2-636s21c1
Sequence:CCGGCAACGGCAAGTGGTTCGACAACTCGAGTTGTCGAACCACTTGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003278.2-183s21c1
Sequence:CCGGGAAGATTGTAAATGCCAAGAACTCGAGTTCTTGGCATTTACAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003278
CLEC3B MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 3, member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-169s1c1
Sequence:CCGGCAGAAGCCCAAGAAGATTGTACTCGAGTACAATCTTCTTGGGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-318s1c1
Sequence:CCGGCAAGGTGCACATGAAATGCTTCTCGAGAAGCATTTCATGTGCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-550s1c1
Sequence:CCGGGCCTACAAGAACTGGGAGACTCTCGAGAGTCTCCCAGTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-201s1c1
Sequence:CCGGAGATGTTGTGAACACAAAGATCTCGAGATCTTTGTGTTCACAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003278.2-221s21c1
Sequence:CCGGAGATGTTTGAGGAGCTCAAGACTCGAGTCTTGAGCTCCTCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003278.2-636s21c1
Sequence:CCGGCAACGGCAAGTGGTTCGACAACTCGAGTTGTCGAACCACTTGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003278.2-183s21c1
Sequence:CCGGGAAGATTGTAAATGCCAAGAACTCGAGTTCTTGGCATTTACAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003278
CLEC3B MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 3, member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-169s1c1
Sequence:CCGGCAGAAGCCCAAGAAGATTGTACTCGAGTACAATCTTCTTGGGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-318s1c1
Sequence:CCGGCAAGGTGCACATGAAATGCTTCTCGAGAAGCATTTCATGTGCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-550s1c1
Sequence:CCGGGCCTACAAGAACTGGGAGACTCTCGAGAGTCTCCCAGTTCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003278.1-201s1c1
Sequence:CCGGAGATGTTGTGAACACAAAGATCTCGAGATCTTTGTGTTCACAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003278.2-221s21c1
Sequence:CCGGAGATGTTTGAGGAGCTCAAGACTCGAGTCTTGAGCTCCTCAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003278.2-636s21c1
Sequence:CCGGCAACGGCAAGTGGTTCGACAACTCGAGTTGTCGAACCACTTGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003278.2-183s21c1
Sequence:CCGGGAAGATTGTAAATGCCAAGAACTCGAGTTCTTGGCATTTACAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks