EMAIL THIS PAGE TO A FRIEND

CLEC4A

C-type lectin domain family 4, member A

98 Gene Product Result for
Synonyms: CLECSF6 DCIR DDB27 LLIR
UniProtKB ID: Q9UMR7, Q17R69, Q8WXW9, Q9H2Z9, Q9NS33, Q9UI34
Gene ID:
Human(50856) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in inflammatory and immune response. Multiple transcript variants encoding distinct isoforms have been identified for this gene. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
Rat(474143) C-type lectin domain family 4, member A
dog(100685575) C-type lectin domain family 4, member A
cow(616674) C-type lectin domain family 4, member A
domestic cat(100113478) C-type lectin domain family 4, member A
naked mole-rat(101711535) C-type lectin domain family 4, member A
domestic guinea pig(100735190) C-type lectin domain family 4, member A
sheep(101104478) C-type lectin domain family 4, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016184 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076521 MISSION® esiRNA esiRNA human CLEC4A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016184 Rosetta Predictions human pricing
NM_194447 Rosetta Predictions human pricing
NM_194448 Rosetta Predictions human pricing
NM_194450 Rosetta Predictions human pricing
NM_001005899 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349006 predicted 947
2 SASI_Hs02_00349007 predicted 811
3 SASI_Hs02_00349008 predicted 992
4 SASI_Hs02_00349009 predicted 1054
5 SASI_Hs02_00349010 predicted 952
6 SASI_Hs01_00038484 predicted 804
7 SASI_Hs02_00349011 predicted 944
8 SASI_Hs02_00349012 predicted 969
9 SASI_Hs02_00349013 predicted 1039
10 SASI_Hs02_00349014 predicted 994
11 SASI_Hs01_00038483 predicted 899
12 SASI_Hs01_00038485 predicted 897
13 SASI_Hs01_00038486 predicted 856
14 SASI_Hs01_00038487 predicted 848
15 SASI_Hs01_00038488 predicted 847
16 SASI_Hs01_00038489 predicted 850
17 SASI_Hs01_00038490 predicted 901
18 SASI_Hs01_00038491 predicted 911
19 SASI_Hs01_00038492 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371509 predicted 728
2 SASI_Hs01_00105092 predicted 684
3 SASI_Hs02_00371510 predicted 771
4 SASI_Hs02_00371511 predicted 731
5 SASI_Hs02_00371512 predicted 728
6 SASI_Hs02_00371513 predicted 726
7 SASI_Hs02_00371514 predicted 730
8 SASI_Hs01_00105095 predicted 775
9 SASI_Hs02_00371515 predicted 781
10 SASI_Hs02_00371516 predicted 722
11 SASI_Hs01_00105087 predicted 881
12 SASI_Hs01_00105088 predicted 773
13 SASI_Hs01_00105089 predicted 894
14 SASI_Hs01_00105090 predicted 934
15 SASI_Hs01_00105091 predicted 839
16 SASI_Hs01_00105093 predicted 838
17 SASI_Hs01_00105094 predicted 851
18 SASI_Hs01_00105096 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371517 predicted 624
2 SASI_Hs01_00122713 predicted 587
3 SASI_Hs02_00371518 predicted 673
4 SASI_Hs02_00371519 predicted 634
5 SASI_Hs02_00371520 predicted 628
6 SASI_Hs02_00371521 predicted 627
7 SASI_Hs02_00371522 predicted 629
8 SASI_Hs01_00122716 predicted 680
9 SASI_Hs02_00371523 predicted 688
10 SASI_Hs02_00371524 predicted 622
11 SASI_Hs01_00122708 predicted 781
12 SASI_Hs01_00122709 predicted 674
13 SASI_Hs01_00122710 predicted 793
14 SASI_Hs01_00122711 predicted 847
15 SASI_Hs01_00122712 predicted 740
16 SASI_Hs01_00122714 predicted 738
17 SASI_Hs01_00122715 predicted 754
18 SASI_Hs01_00122717 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371526 predicted 748
2 SASI_Hs01_00019663 predicted 709
3 SASI_Hs01_00019664 predicted 793
4 SASI_Hs01_00019665 predicted 745
5 SASI_Hs01_00019666 predicted 745
6 SASI_Hs01_00019667 predicted 750
7 SASI_Hs01_00019668 predicted 744
8 SASI_Hs01_00019669 predicted 795
9 SASI_Hs01_00019670 predicted 802
10 SASI_Hs01_00019671 predicted 739
11 SASI_Hs01_00019662 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046854 predicted 498
2 SASI_Rn02_00198485 predicted 524
3 SASI_Rn01_00046855 predicted 589
4 SASI_Rn01_00046856 predicted 534
5 SASI_Rn02_00198486 predicted 498
6 SASI_Rn01_00046857 predicted 586
7 SASI_Rn01_00046858 predicted 527
8 SASI_Rn01_00046859 predicted 562
9 SASI_Rn01_00046861 predicted 547
10 SASI_Rn01_00046862 predicted 569
11 SASI_Rn01_00046860 predicted 506
12 SASI_Rn01_00046863 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016184
CLEC4A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016184.3-1062s21c1
Sequence:CCGGTTAGGTGGTCTGTCAACTATTCTCGAGAATAGTTGACAGACCACCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016184.3-494s21c1
Sequence:CCGGGAGCTGGTTCATACAACATTGCTCGAGCAATGTTGTATGAACCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-564s1c1
Sequence:CCGGGCCCAAAGAATTGGAAGTCATCTCGAGATGACTTCCAATTCTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-694s1c1
Sequence:CCGGGCAGGATTTCATCTTCCAGAACTCGAGTTCTGGAAGATGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-850s1c1
Sequence:CCGGGCGCTGCGTTGTGCTAAATTTCTCGAGAAATTTAGCACAACGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-718s1c1
Sequence:CCGGGCAAGAAGAATCTGCTTATTTCTCGAGAAATAAGCAGATTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-409s1c1
Sequence:CCGGCCTGCTATTGGCAATCTCATTCTCGAGAATGAGATTGCCAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016184
CLEC4A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016184.3-1062s21c1
Sequence:CCGGTTAGGTGGTCTGTCAACTATTCTCGAGAATAGTTGACAGACCACCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016184.3-494s21c1
Sequence:CCGGGAGCTGGTTCATACAACATTGCTCGAGCAATGTTGTATGAACCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-564s1c1
Sequence:CCGGGCCCAAAGAATTGGAAGTCATCTCGAGATGACTTCCAATTCTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-694s1c1
Sequence:CCGGGCAGGATTTCATCTTCCAGAACTCGAGTTCTGGAAGATGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-850s1c1
Sequence:CCGGGCGCTGCGTTGTGCTAAATTTCTCGAGAAATTTAGCACAACGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-718s1c1
Sequence:CCGGGCAAGAAGAATCTGCTTATTTCTCGAGAAATAAGCAGATTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-409s1c1
Sequence:CCGGCCTGCTATTGGCAATCTCATTCTCGAGAATGAGATTGCCAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016184
CLEC4A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016184.3-1062s21c1
Sequence:CCGGTTAGGTGGTCTGTCAACTATTCTCGAGAATAGTTGACAGACCACCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016184.3-494s21c1
Sequence:CCGGGAGCTGGTTCATACAACATTGCTCGAGCAATGTTGTATGAACCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-564s1c1
Sequence:CCGGGCCCAAAGAATTGGAAGTCATCTCGAGATGACTTCCAATTCTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-694s1c1
Sequence:CCGGGCAGGATTTCATCTTCCAGAACTCGAGTTCTGGAAGATGAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-850s1c1
Sequence:CCGGGCGCTGCGTTGTGCTAAATTTCTCGAGAAATTTAGCACAACGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-718s1c1
Sequence:CCGGGCAAGAAGAATCTGCTTATTTCTCGAGAAATAAGCAGATTCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016184.2-409s1c1
Sequence:CCGGCCTGCTATTGGCAATCTCATTCTCGAGAATGAGATTGCCAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks