EMAIL THIS PAGE TO A FRIEND

CLEC4C

C-type lectin domain family 4, member C

36 Gene Product Result for
Synonyms: BDCA2 CD303 CLECSF11 CLECSF7 DLEC HECL PRO34150
Species: Human CLEC4C(170482), domestic guinea pig Clec4c(100733227), naked mole-rat Clec4c(101724192)
UniProtKB ID: Q8WTT0, D3DUU3, Q3T1C3, Q6UXS8, Q8WXX8
Gene ID:
Human(170482) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in dendritic cell function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
domestic guinea pig(100733227) C-type lectin domain family 4, member C
naked mole-rat(101724192) C-type lectin domain family 4, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130441 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130441 Rosetta Predictions human pricing
NM_203503 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161305 predicted 829
2 SASI_Hs01_00161306 predicted 984
3 SASI_Hs01_00161308 predicted 1015
4 SASI_Hs01_00161309 predicted 868
5 SASI_Hs01_00161311 predicted 853
6 SASI_Hs01_00161312 predicted 1011
7 SASI_Hs01_00161313 predicted 991
8 SASI_Hs01_00161314 predicted 1017
9 SASI_Hs02_00362740 predicted 839
10 SASI_Hs02_00362741 predicted 978
11 SASI_Hs01_00161307 predicted 1022
12 SASI_Hs01_00161310 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015199 predicted 744
2 SASI_Hs01_00015200 predicted 895
3 SASI_Hs01_00015202 predicted 923
4 SASI_Hs01_00015203 predicted 773
5 SASI_Hs01_00015205 predicted 762
6 SASI_Hs01_00015206 predicted 919
7 SASI_Hs01_00015207 predicted 899
8 SASI_Hs01_00015208 predicted 923
9 SASI_Hs02_00373440 predicted 746
10 SASI_Hs02_00373441 predicted 890
11 SASI_Hs01_00015201 predicted 935
12 SASI_Hs01_00015204 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130441
CLEC4C MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-653s1c1
Sequence:CCGGGCTGTCCAAGTTACGAGAGTACTCGAGTACTCTCGTAACTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-666s1c1
Sequence:CCGGCGAGAGTATCAACAGTATCATCTCGAGATGATACTGTTGATACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-869s1c1
Sequence:CCGGACAGGATTTCATCATTCAGAACTCGAGTTCTGAATGATGAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-761s1c1
Sequence:CCGGTCAGTCTAGTTGCTACTTTATCTCGAGATAAAGTAGCAACTAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-1086s1c1
Sequence:CCGGCATGTACCTCAGAAGTCAATTCTCGAGAATTGACTTCTGAGGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130441.2-1021s21c1
Sequence:CCGGATGAGCGTTGTGCGATAATAACTCGAGTTATTATCGCACAACGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130441.2-995s21c1
Sequence:CCGGGCACTCAGGTGAACCCAATAACTCGAGTTATTGGGTTCACCTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130441
CLEC4C MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-653s1c1
Sequence:CCGGGCTGTCCAAGTTACGAGAGTACTCGAGTACTCTCGTAACTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-666s1c1
Sequence:CCGGCGAGAGTATCAACAGTATCATCTCGAGATGATACTGTTGATACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-869s1c1
Sequence:CCGGACAGGATTTCATCATTCAGAACTCGAGTTCTGAATGATGAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-761s1c1
Sequence:CCGGTCAGTCTAGTTGCTACTTTATCTCGAGATAAAGTAGCAACTAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-1086s1c1
Sequence:CCGGCATGTACCTCAGAAGTCAATTCTCGAGAATTGACTTCTGAGGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130441.2-1021s21c1
Sequence:CCGGATGAGCGTTGTGCGATAATAACTCGAGTTATTATCGCACAACGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130441.2-995s21c1
Sequence:CCGGGCACTCAGGTGAACCCAATAACTCGAGTTATTGGGTTCACCTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130441
CLEC4C MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-653s1c1
Sequence:CCGGGCTGTCCAAGTTACGAGAGTACTCGAGTACTCTCGTAACTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-666s1c1
Sequence:CCGGCGAGAGTATCAACAGTATCATCTCGAGATGATACTGTTGATACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-869s1c1
Sequence:CCGGACAGGATTTCATCATTCAGAACTCGAGTTCTGAATGATGAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-761s1c1
Sequence:CCGGTCAGTCTAGTTGCTACTTTATCTCGAGATAAAGTAGCAACTAGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130441.2-1086s1c1
Sequence:CCGGCATGTACCTCAGAAGTCAATTCTCGAGAATTGACTTCTGAGGTACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130441.2-1021s21c1
Sequence:CCGGATGAGCGTTGTGCGATAATAACTCGAGTTATTATCGCACAACGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130441.2-995s21c1
Sequence:CCGGGCACTCAGGTGAACCCAATAACTCGAGTTATTGGGTTCACCTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks