EMAIL THIS PAGE TO A FRIEND

CLEC4D

C-type lectin domain family 4, member D

131 Gene Product Result for
Synonyms: CLEC-6 CLEC6 CLECSF8 MCL MPCL
UniProtKB ID: Q8WXI8, Q8N5J5
Gene ID:
Human(338339) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
Mouse(17474) C-type lectin domain family 4, member d
Rat(362432) C-type lectin domain family 4, member D
cow(616646) C-type lectin domain family 4, member D
domestic cat(101095108) C-type lectin domain family 4, member D
dog(611536) C-type lectin domain family 4, member D
naked mole-rat(101701493) C-type lectin domain family 4, member D
domestic guinea pig(100727116) C-type lectin domain family 4, member D
sheep(101104735) C-type lectin domain family 4, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136511 MISSION® esiRNA esiRNA human CLEC4D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080387 Rosetta Predictions human pricing
NM_001003707 Rosetta Predictions rat pricing
XM_579104 Rosetta Predictions rat pricing
NM_010819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134210 predicted 1333
2 SASI_Hs01_00134211 predicted 589
3 SASI_Hs01_00134212 predicted 355
4 SASI_Hs01_00134213 predicted 562
5 SASI_Hs02_00362218 predicted 610
6 SASI_Hs01_00134214 predicted 696
7 SASI_Hs01_00134215 predicted 490
8 SASI_Hs01_00134216 predicted 594
9 SASI_Hs01_00134218 predicted 1229
10 SASI_Hs02_00362219 predicted 350
11 SASI_Hs01_00134217 predicted 1333
12 SASI_Hs01_00134219 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057215 predicted 438
2 SASI_Rn01_00057216 predicted 193
3 SASI_Rn01_00057217 predicted 296
4 SASI_Rn01_00057218 predicted 365
5 SASI_Rn01_00057219 predicted 306
6 SASI_Rn01_00057220 predicted 290
7 SASI_Rn01_00057221 predicted 297
8 SASI_Rn01_00057222 predicted 331
9 SASI_Rn01_00057223 predicted 278
10 SASI_Rn01_00057224 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123294 predicted 446
2 SASI_Rn01_00123295 predicted 201
3 SASI_Rn01_00123296 predicted 304
4 SASI_Rn01_00123297 predicted 376
5 SASI_Rn01_00123298 predicted 307
6 SASI_Rn01_00123299 predicted 294
7 SASI_Rn01_00123300 predicted 307
8 SASI_Rn01_00123301 predicted 338
9 SASI_Rn01_00123302 predicted 275
10 SASI_Rn01_00123303 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154457 predicted 288
2 SASI_Mm01_00154458 predicted 533
3 SASI_Mm01_00154459 predicted 334
4 SASI_Mm01_00154460 predicted 498
5 SASI_Mm01_00154461 predicted 363
6 SASI_Mm01_00154462 predicted 791
7 SASI_Mm01_00154464 predicted 388
8 SASI_Mm01_00154465 predicted 263
9 SASI_Mm01_00154466 predicted 227
10 SASI_Mm02_00319423 predicted 799
11 SASI_Mm01_00154463 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080387
CLEC4D MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member D
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080387.4-1088s21c1
Sequence:CCGGAGTAGTATTTCAAGGTGTTTACTCGAGTAAACACCTTGAAATACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080387.4-1138s21c1
Sequence:CCGGTATGGAAGAATAGCGTGAATACTCGAGTATTCACGCTATTCTTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-569s1c1
Sequence:CCGGGCTGAGCAGAACTTTATTATTCTCGAGAATAATAAAGTTCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-251s1c1
Sequence:CCGGCCTTCGGTTATTGCTGTAGTTCTCGAGAACTACAGCAATAACCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-302s1c1
Sequence:CCGGGCAAGTTGTTTGGTGACTCATCTCGAGATGAGTCACCAAACAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-757s1c1
Sequence:CCGGCCAAGATAAATGGGCCTGGAACTCGAGTTCCAGGCCCATTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-700s1c1
Sequence:CCGGGCATAAGAATGAACCCGACAACTCGAGTTGTCGGGTTCATTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080387
CLEC4D MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member D
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080387.4-1088s21c1
Sequence:CCGGAGTAGTATTTCAAGGTGTTTACTCGAGTAAACACCTTGAAATACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080387.4-1138s21c1
Sequence:CCGGTATGGAAGAATAGCGTGAATACTCGAGTATTCACGCTATTCTTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-569s1c1
Sequence:CCGGGCTGAGCAGAACTTTATTATTCTCGAGAATAATAAAGTTCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-251s1c1
Sequence:CCGGCCTTCGGTTATTGCTGTAGTTCTCGAGAACTACAGCAATAACCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-302s1c1
Sequence:CCGGGCAAGTTGTTTGGTGACTCATCTCGAGATGAGTCACCAAACAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-757s1c1
Sequence:CCGGCCAAGATAAATGGGCCTGGAACTCGAGTTCCAGGCCCATTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-700s1c1
Sequence:CCGGGCATAAGAATGAACCCGACAACTCGAGTTGTCGGGTTCATTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080387
CLEC4D MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member D
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080387.4-1088s21c1
Sequence:CCGGAGTAGTATTTCAAGGTGTTTACTCGAGTAAACACCTTGAAATACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080387.4-1138s21c1
Sequence:CCGGTATGGAAGAATAGCGTGAATACTCGAGTATTCACGCTATTCTTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-569s1c1
Sequence:CCGGGCTGAGCAGAACTTTATTATTCTCGAGAATAATAAAGTTCTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-251s1c1
Sequence:CCGGCCTTCGGTTATTGCTGTAGTTCTCGAGAACTACAGCAATAACCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-302s1c1
Sequence:CCGGGCAAGTTGTTTGGTGACTCATCTCGAGATGAGTCACCAAACAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-757s1c1
Sequence:CCGGCCAAGATAAATGGGCCTGGAACTCGAGTTCCAGGCCCATTTATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080387.4-700s1c1
Sequence:CCGGGCATAAGAATGAACCCGACAACTCGAGTTGTCGGGTTCATTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010819
VALIDATED
CLEC4D MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member D
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.4-342s21c1
Sequence:CCGGTTGTTTGGTGACTCATCATTACTCGAGTAATGATGAGTCACCAAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.4-692s21c1
Sequence:CCGGGGGTGGACAAGACGCCATTTACTCGAGTAAATGGCGTCTTGTCCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.3-485s21c1
Sequence:CCGGCTTCCAGTCTAACTGTTACTTCTCGAGAAGTAACAGTTAGACTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010819.3-920s21c1
Sequence:CCGGGAAAGTGTCCTTGCATCATAGCTCGAGCTATGATGCAAGGACACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010819.3-392s21c1
Sequence:CCGGAGACTACCACACGAGAGTAACCTCGAGGTTACTCTCGTGTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.3-699s21c1
Sequence:CCGGTTTAACCCACACACGGTATTCCTCGAGGAATACCGTGTGTGGGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.3-732s21c1
Sequence:CCGGGAATCCAATGACTTTATGGAACTCGAGTTCCATAAAGTCATTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010819.2-1094s1c1
Sequence:CCGGCACATGCTAATGCACACATATCTCGAGATATGTGTGCATTAGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-288s1c1
Sequence:CCGGCGCTGTTGTTTCCATCTCGTTCTCGAGAACGAGATGGAAACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-486s1c1
Sequence:CCGGCTTCCAGTCTAACTGTTACTTCTCGAGAAGTAACAGTTAGACTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-733s1c1
Sequence:CCGGGAATCCAATGACTTTATGGAACTCGAGTTCCATAAAGTCATTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-305s1c1
Sequence:CCGGCGTTCCTTAGTGCTTGCTTTACTCGAGTAAAGCAAGCACTAAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010819
VALIDATED
CLEC4D MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member D
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.4-342s21c1
Sequence:CCGGTTGTTTGGTGACTCATCATTACTCGAGTAATGATGAGTCACCAAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.4-692s21c1
Sequence:CCGGGGGTGGACAAGACGCCATTTACTCGAGTAAATGGCGTCTTGTCCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.3-485s21c1
Sequence:CCGGCTTCCAGTCTAACTGTTACTTCTCGAGAAGTAACAGTTAGACTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010819.3-920s21c1
Sequence:CCGGGAAAGTGTCCTTGCATCATAGCTCGAGCTATGATGCAAGGACACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010819.3-392s21c1
Sequence:CCGGAGACTACCACACGAGAGTAACCTCGAGGTTACTCTCGTGTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.3-699s21c1
Sequence:CCGGTTTAACCCACACACGGTATTCCTCGAGGAATACCGTGTGTGGGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.3-732s21c1
Sequence:CCGGGAATCCAATGACTTTATGGAACTCGAGTTCCATAAAGTCATTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010819.2-1094s1c1
Sequence:CCGGCACATGCTAATGCACACATATCTCGAGATATGTGTGCATTAGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-288s1c1
Sequence:CCGGCGCTGTTGTTTCCATCTCGTTCTCGAGAACGAGATGGAAACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-486s1c1
Sequence:CCGGCTTCCAGTCTAACTGTTACTTCTCGAGAAGTAACAGTTAGACTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-733s1c1
Sequence:CCGGGAATCCAATGACTTTATGGAACTCGAGTTCCATAAAGTCATTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-305s1c1
Sequence:CCGGCGTTCCTTAGTGCTTGCTTTACTCGAGTAAAGCAAGCACTAAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010819
VALIDATED
CLEC4D MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member D
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.4-342s21c1
Sequence:CCGGTTGTTTGGTGACTCATCATTACTCGAGTAATGATGAGTCACCAAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.4-692s21c1
Sequence:CCGGGGGTGGACAAGACGCCATTTACTCGAGTAAATGGCGTCTTGTCCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.3-485s21c1
Sequence:CCGGCTTCCAGTCTAACTGTTACTTCTCGAGAAGTAACAGTTAGACTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010819.3-920s21c1
Sequence:CCGGGAAAGTGTCCTTGCATCATAGCTCGAGCTATGATGCAAGGACACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010819.3-392s21c1
Sequence:CCGGAGACTACCACACGAGAGTAACCTCGAGGTTACTCTCGTGTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.3-699s21c1
Sequence:CCGGTTTAACCCACACACGGTATTCCTCGAGGAATACCGTGTGTGGGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010819.3-732s21c1
Sequence:CCGGGAATCCAATGACTTTATGGAACTCGAGTTCCATAAAGTCATTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010819.2-1094s1c1
Sequence:CCGGCACATGCTAATGCACACATATCTCGAGATATGTGTGCATTAGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-288s1c1
Sequence:CCGGCGCTGTTGTTTCCATCTCGTTCTCGAGAACGAGATGGAAACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-486s1c1
Sequence:CCGGCTTCCAGTCTAACTGTTACTTCTCGAGAAGTAACAGTTAGACTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-733s1c1
Sequence:CCGGGAATCCAATGACTTTATGGAACTCGAGTTCCATAAAGTCATTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010819.2-305s1c1
Sequence:CCGGCGTTCCTTAGTGCTTGCTTTACTCGAGTAAAGCAAGCACTAAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks