EMAIL THIS PAGE TO A FRIEND

CLEC4E

C-type lectin domain family 4, member E

89 Gene Product Result for
Synonyms: CLECSF9 MINCLE
UniProtKB ID: Q9ULY5, B2R6Q6
Gene ID:
Human(26253) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein is a downstream target of CCAAT/enhancer binding protein (C/EBP), beta (CEBPB) and may play a role in inflammation. Alternative splice variants have been described but their full-length sequence has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
Mouse(56619) C-type lectin domain family 4, member e
Rat(450223) C-type lectin domain family 4, member E
sheep(100135686) C-type lectin domain family 4, member E
domestic guinea pig(100726838) C-type lectin domain family 4, member E
naked mole-rat(101700910) C-type lectin domain family 4, member E
cow(514797) C-type lectin domain family 4, member E
domestic cat(101094859) C-type lectin domain family 4, member E
dog(611538) C-type lectin domain family 4, member E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014358 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014358 Rosetta Predictions human pricing
NM_001005897 Rosetta Predictions rat pricing
NM_019948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211226 predicted 743
2 SASI_Hs01_00211227 predicted 911
3 SASI_Hs01_00211228 predicted 888
4 SASI_Hs01_00211229 predicted 831
5 SASI_Hs01_00211230 predicted 337
6 SASI_Hs01_00211232 predicted 452
7 SASI_Hs01_00211233 predicted 404
8 SASI_Hs01_00211234 predicted 978
9 SASI_Hs01_00211235 predicted 446
10 SASI_Hs02_00345504 predicted 528
11 SASI_Hs01_00211231 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103200 predicted 354
2 SASI_Rn01_00103201 predicted 384
3 SASI_Rn01_00103202 predicted 240
4 SASI_Rn01_00103204 predicted 342
5 SASI_Rn02_00198484 predicted 264
6 SASI_Rn01_00103205 predicted 342
7 SASI_Rn01_00103206 predicted 236
8 SASI_Rn01_00103207 predicted 394
9 SASI_Rn01_00103208 predicted 254
10 SASI_Rn01_00103209 predicted 357
11 SASI_Rn01_00103203 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161172 predicted 683
2 SASI_Mm01_00161173 predicted 361
3 SASI_Mm01_00161174 predicted 743
4 SASI_Mm01_00161175 predicted 810
5 SASI_Mm01_00161176 predicted 985
6 SASI_Mm01_00161177 predicted 375
7 SASI_Mm01_00161179 predicted 886
8 SASI_Mm01_00161180 predicted 698
9 SASI_Mm01_00161181 predicted 941
10 SASI_Mm02_00325245 predicted 980
11 SASI_Mm01_00161178 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019948
CLEC4E MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member E
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019948.1-1308s1c1
Sequence:CCGGCGGTCAAACTTCAGTTCCTAACTCGAGTTAGGAACTGAAGTTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-364s1c1
Sequence:CCGGCCTTTGAACTGGAAACATTATCTCGAGATAATGTTTCCAGTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-687s1c1
Sequence:CCGGCAGGAAGAACTGGAATGATATCTCGAGATATCATTCCAGTTCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-347s1c1
Sequence:CCGGCAGTCAAGAATTGCTGTCCTTCTCGAGAAGGACAGCAATTCTTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-219s1c1
Sequence:CCGGCCTGTTTCTCAGTGGCTGTTTCTCGAGAAACAGCCACTGAGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019948.2-244s21c1
Sequence:CCGGACCAGATGTGTCGTAACATATCTCGAGATATGTTACGACACATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019948.2-982s21c1
Sequence:CCGGTTTAGACTGTACAGATCAATTCTCGAGAATTGATCTGTACAGTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019948.2-734s21c1
Sequence:CCGGTTTGTGAGATGCCAGAAATAACTCGAGTTATTTCTGGCATCTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019948
CLEC4E MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member E
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019948.1-1308s1c1
Sequence:CCGGCGGTCAAACTTCAGTTCCTAACTCGAGTTAGGAACTGAAGTTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-364s1c1
Sequence:CCGGCCTTTGAACTGGAAACATTATCTCGAGATAATGTTTCCAGTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-687s1c1
Sequence:CCGGCAGGAAGAACTGGAATGATATCTCGAGATATCATTCCAGTTCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-347s1c1
Sequence:CCGGCAGTCAAGAATTGCTGTCCTTCTCGAGAAGGACAGCAATTCTTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-219s1c1
Sequence:CCGGCCTGTTTCTCAGTGGCTGTTTCTCGAGAAACAGCCACTGAGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019948.2-244s21c1
Sequence:CCGGACCAGATGTGTCGTAACATATCTCGAGATATGTTACGACACATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019948.2-982s21c1
Sequence:CCGGTTTAGACTGTACAGATCAATTCTCGAGAATTGATCTGTACAGTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019948.2-734s21c1
Sequence:CCGGTTTGTGAGATGCCAGAAATAACTCGAGTTATTTCTGGCATCTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019948
CLEC4E MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member E
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019948.1-1308s1c1
Sequence:CCGGCGGTCAAACTTCAGTTCCTAACTCGAGTTAGGAACTGAAGTTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-364s1c1
Sequence:CCGGCCTTTGAACTGGAAACATTATCTCGAGATAATGTTTCCAGTTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-687s1c1
Sequence:CCGGCAGGAAGAACTGGAATGATATCTCGAGATATCATTCCAGTTCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-347s1c1
Sequence:CCGGCAGTCAAGAATTGCTGTCCTTCTCGAGAAGGACAGCAATTCTTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019948.1-219s1c1
Sequence:CCGGCCTGTTTCTCAGTGGCTGTTTCTCGAGAAACAGCCACTGAGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019948.2-244s21c1
Sequence:CCGGACCAGATGTGTCGTAACATATCTCGAGATATGTTACGACACATCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019948.2-982s21c1
Sequence:CCGGTTTAGACTGTACAGATCAATTCTCGAGAATTGATCTGTACAGTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019948.2-734s21c1
Sequence:CCGGTTTGTGAGATGCCAGAAATAACTCGAGTTATTTCTGGCATCTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014358
CLEC4E MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member E
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014358.1-1023s1c1
Sequence:CCGGCCCAGAATTTACAAAGCAATTCTCGAGAATTGCTTTGTAAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-290s1c1
Sequence:CCGGCGCATCTTTCAAACCTGTGATCTCGAGATCACAGGTTTGAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-354s1c1
Sequence:CCGGGCTACAATTATGGATCAGGTTCTCGAGAACCTGATCCATAATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-209s1c1
Sequence:CCGGCAAATGTTCTTATGGACTGTTCTCGAGAACAGTCCATAAGAACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-530s1c1
Sequence:CCGGCTTTCCTACAAGAAACCTAAACTCGAGTTTAGGTTTCTTGTAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014358.2-455s21c1
Sequence:CCGGACACCATTTCCTGGGCGTTAACTCGAGTTAACGCCCAGGAAATGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014358.2-747s21c1
Sequence:CCGGTGTAACCTGTTTCCTCAATTACTCGAGTAATTGAGGAAACAGGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014358.2-912s21c1
Sequence:CCGGGAACTTCAAAGGACTTCATAACTCGAGTTATGAAGTCCTTTGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014358
CLEC4E MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member E
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014358.1-1023s1c1
Sequence:CCGGCCCAGAATTTACAAAGCAATTCTCGAGAATTGCTTTGTAAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-290s1c1
Sequence:CCGGCGCATCTTTCAAACCTGTGATCTCGAGATCACAGGTTTGAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-354s1c1
Sequence:CCGGGCTACAATTATGGATCAGGTTCTCGAGAACCTGATCCATAATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-209s1c1
Sequence:CCGGCAAATGTTCTTATGGACTGTTCTCGAGAACAGTCCATAAGAACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-530s1c1
Sequence:CCGGCTTTCCTACAAGAAACCTAAACTCGAGTTTAGGTTTCTTGTAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014358.2-455s21c1
Sequence:CCGGACACCATTTCCTGGGCGTTAACTCGAGTTAACGCCCAGGAAATGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014358.2-747s21c1
Sequence:CCGGTGTAACCTGTTTCCTCAATTACTCGAGTAATTGAGGAAACAGGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014358.2-912s21c1
Sequence:CCGGGAACTTCAAAGGACTTCATAACTCGAGTTATGAAGTCCTTTGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014358
CLEC4E MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member E
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014358.1-1023s1c1
Sequence:CCGGCCCAGAATTTACAAAGCAATTCTCGAGAATTGCTTTGTAAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-290s1c1
Sequence:CCGGCGCATCTTTCAAACCTGTGATCTCGAGATCACAGGTTTGAAAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-354s1c1
Sequence:CCGGGCTACAATTATGGATCAGGTTCTCGAGAACCTGATCCATAATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-209s1c1
Sequence:CCGGCAAATGTTCTTATGGACTGTTCTCGAGAACAGTCCATAAGAACATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014358.1-530s1c1
Sequence:CCGGCTTTCCTACAAGAAACCTAAACTCGAGTTTAGGTTTCTTGTAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014358.2-455s21c1
Sequence:CCGGACACCATTTCCTGGGCGTTAACTCGAGTTAACGCCCAGGAAATGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014358.2-747s21c1
Sequence:CCGGTGTAACCTGTTTCCTCAATTACTCGAGTAATTGAGGAAACAGGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014358.2-912s21c1
Sequence:CCGGGAACTTCAAAGGACTTCATAACTCGAGTTATGAAGTCCTTTGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks