EMAIL THIS PAGE TO A FRIEND

CLEC4F

C-type lectin domain family 4, member F

66 Gene Product Result for
Synonyms: CLECSF13 KCLR
UniProtKB ID: Q8N1N0
Gene ID:
Mouse(51811) C-type lectin domain family 4, member f
Rat(114598) C-type lectin domain family 4, member F
dog(481424) C-type lectin domain family 4, member F
domestic cat(101095892) C-type lectin domain family 4, member F
cow(511001) C-type lectin domain family 4, member F
Horse(100060281) C-type lectin domain family 4, member F
naked mole-rat(101722072) C-type lectin domain family 4, member F
domestic guinea pig(100717739) C-type lectin domain family 4, member F
sheep(101102383) C-type lectin domain family 4, member F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173535 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026691 MISSION® esiRNA esiRNA human CLEC4F (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173535 Rosetta Predictions human pricing
NM_053753 Rosetta Predictions rat pricing
NM_016751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079479 predicted 845
2 SASI_Hs02_00368328 predicted 550
3 SASI_Hs01_00079480 predicted 703
4 SASI_Hs01_00079481 predicted 1933
5 SASI_Hs02_00368329 predicted 1704
6 SASI_Hs01_00079482 predicted 1528
7 SASI_Hs01_00079483 predicted 1147
8 SASI_Hs01_00079485 predicted 638
9 SASI_Hs01_00079486 predicted 791
10 SASI_Hs01_00079487 predicted 1054
11 SASI_Hs01_00079484 predicted 1039
12 SASI_Hs01_00079488 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117295 predicted 1594
2 SASI_Rn01_00117296 predicted 833
3 SASI_Rn01_00117297 predicted 1642
4 SASI_Rn01_00117298 predicted 899
5 SASI_Rn01_00117299 predicted 872
6 SASI_Rn01_00117300 predicted 307
7 SASI_Rn01_00117301 predicted 597
8 SASI_Rn02_00266537 predicted 800
9 SASI_Rn01_00117302 predicted 492
10 SASI_Rn01_00117303 predicted 318
11 SASI_Rn01_00117304 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078093 predicted 1630
2 SASI_Mm01_00078094 predicted 373
3 SASI_Mm01_00078095 predicted 462
4 SASI_Mm01_00078096 predicted 1045
5 SASI_Mm01_00078098 predicted 225
6 SASI_Mm02_00323486 predicted 1712
7 SASI_Mm01_00078099 predicted 395
8 SASI_Mm01_00078100 predicted 625
9 SASI_Mm01_00078101 predicted 878
10 SASI_Mm01_00078102 predicted 409
11 SASI_Mm01_00078097 predicted 515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173535
CLEC4F MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member F
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173535.2-823s21c1
Sequence:CCGGACGCTAATGCTGAGATCTATGCTCGAGCATAGATCTCAGCATTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173535.2-1143s21c1
Sequence:CCGGGATACTCAGATTCAGGTATTCCTCGAGGAATACCTGAATCTGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-1197s1c1
Sequence:CCGGGCCCAGATTCAGGTCTTAAATCTCGAGATTTAAGACCTGAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-389s1c1
Sequence:CCGGCCAGACATTTAAAGGCCACATCTCGAGATGTGGCCTTTAAATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-339s1c1
Sequence:CCGGCCCAACAATCATCACCACTTTCTCGAGAAAGTGGTGATGATTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-1417s1c1
Sequence:CCGGCCCTCCATGTGGTCATTACTTCTCGAGAAGTAATGACCACATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-769s1c1
Sequence:CCGGCCAGTTTGGAAACGGCAAATACTCGAGTATTTGCCGTTTCCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173535
CLEC4F MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member F
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173535.2-823s21c1
Sequence:CCGGACGCTAATGCTGAGATCTATGCTCGAGCATAGATCTCAGCATTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173535.2-1143s21c1
Sequence:CCGGGATACTCAGATTCAGGTATTCCTCGAGGAATACCTGAATCTGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-1197s1c1
Sequence:CCGGGCCCAGATTCAGGTCTTAAATCTCGAGATTTAAGACCTGAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-389s1c1
Sequence:CCGGCCAGACATTTAAAGGCCACATCTCGAGATGTGGCCTTTAAATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-339s1c1
Sequence:CCGGCCCAACAATCATCACCACTTTCTCGAGAAAGTGGTGATGATTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-1417s1c1
Sequence:CCGGCCCTCCATGTGGTCATTACTTCTCGAGAAGTAATGACCACATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-769s1c1
Sequence:CCGGCCAGTTTGGAAACGGCAAATACTCGAGTATTTGCCGTTTCCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173535
CLEC4F MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member F
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173535.2-823s21c1
Sequence:CCGGACGCTAATGCTGAGATCTATGCTCGAGCATAGATCTCAGCATTAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173535.2-1143s21c1
Sequence:CCGGGATACTCAGATTCAGGTATTCCTCGAGGAATACCTGAATCTGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-1197s1c1
Sequence:CCGGGCCCAGATTCAGGTCTTAAATCTCGAGATTTAAGACCTGAATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-389s1c1
Sequence:CCGGCCAGACATTTAAAGGCCACATCTCGAGATGTGGCCTTTAAATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-339s1c1
Sequence:CCGGCCCAACAATCATCACCACTTTCTCGAGAAAGTGGTGATGATTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-1417s1c1
Sequence:CCGGCCCTCCATGTGGTCATTACTTCTCGAGAAGTAATGACCACATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173535.1-769s1c1
Sequence:CCGGCCAGTTTGGAAACGGCAAATACTCGAGTATTTGCCGTTTCCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016751
CLEC4F MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member F
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016751.2-2173s1c1
Sequence:CCGGCCTGTCATTCATCTTGCTAATCTCGAGATTAGCAAGATGAATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-212s1c1
Sequence:CCGGGTCCAGGTCATTCTGGCATTACTCGAGTAATGCCAGAATGACCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-214s1c1
Sequence:CCGGCCAGGTCATTCTGGCATTAATCTCGAGATTAATGCCAGAATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-353s1c1
Sequence:CCGGCACGACAATCATTCCCAATTTCTCGAGAAATTGGGAATGATTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-832s1c1
Sequence:CCGGCCAGCACAGTATGGACAACATCTCGAGATGTTGTCCATACTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016751
CLEC4F MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member F
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016751.2-2173s1c1
Sequence:CCGGCCTGTCATTCATCTTGCTAATCTCGAGATTAGCAAGATGAATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-212s1c1
Sequence:CCGGGTCCAGGTCATTCTGGCATTACTCGAGTAATGCCAGAATGACCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-214s1c1
Sequence:CCGGCCAGGTCATTCTGGCATTAATCTCGAGATTAATGCCAGAATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-353s1c1
Sequence:CCGGCACGACAATCATTCCCAATTTCTCGAGAAATTGGGAATGATTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-832s1c1
Sequence:CCGGCCAGCACAGTATGGACAACATCTCGAGATGTTGTCCATACTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016751
CLEC4F MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member F
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016751.2-2173s1c1
Sequence:CCGGCCTGTCATTCATCTTGCTAATCTCGAGATTAGCAAGATGAATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-212s1c1
Sequence:CCGGGTCCAGGTCATTCTGGCATTACTCGAGTAATGCCAGAATGACCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-214s1c1
Sequence:CCGGCCAGGTCATTCTGGCATTAATCTCGAGATTAATGCCAGAATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-353s1c1
Sequence:CCGGCACGACAATCATTCCCAATTTCTCGAGAAATTGGGAATGATTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016751.2-832s1c1
Sequence:CCGGCCAGCACAGTATGGACAACATCTCGAGATGTTGTCCATACTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks