EMAIL THIS PAGE TO A FRIEND

CLEC4G

C-type lectin domain family 4, member G

49 Gene Product Result for
Synonyms: DTTR431 LP2698 LSECtin UNQ431
UniProtKB ID: Q6UXB4
Gene ID:
Human(339390) Summary: This gene encodes a glycan-binding receptor and member of the C-type lectin family which plays a role in the T-cell immune response. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(75863) C-type lectin domain family 4, member g
Rat(689004) C-type lectin domain family 4, member G
sheep(101123627) C-type lectin domain family 4, member G
domestic guinea pig(100720872) C-type lectin domain family 4, member G
naked mole-rat(101705876) C-type lectin domain family 4, member G
dog(484999) C-type lectin domain family 4, member G
domestic cat(101096037) C-type lectin domain family 4, member G
cow(507332) C-type lectin domain family 4, member G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1569 Human LSECtin ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198492 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198492 Rosetta Predictions human pricing
XM_001069149 Rosetta Predictions rat pricing
NM_029465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074703 predicted 923
2 SASI_Hs01_00074704 predicted 430
3 SASI_Hs02_00372059 predicted 969
4 SASI_Hs01_00074705 predicted 976
5 SASI_Hs01_00074706 predicted 793
6 SASI_Hs01_00074708 predicted 1020
7 SASI_Hs02_00372060 predicted 1011
8 SASI_Hs01_00074710 predicted 923
9 SASI_Hs02_00372061 predicted 1032
10 SASI_Hs01_00074711 predicted 915
11 SASI_Hs01_00074707 predicted 1062
12 SASI_Hs01_00074709 predicted 198
13 SASI_Hs01_00074712 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327071 predicted 563
2 SASI_Rn02_00327072 predicted 258
3 SASI_Rn02_00327073 predicted 547
4 SASI_Rn02_00327074 predicted 595
5 SASI_Rn02_00327075 predicted 448
6 SASI_Rn02_00327076 predicted 191
7 SASI_Rn02_00327077 predicted 517
8 SASI_Rn02_00327078 predicted 403
9 SASI_Rn02_00327079 predicted 322
10 SASI_Rn02_00327080 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188879 predicted 560
2 SASI_Mm01_00188881 predicted 994
3 SASI_Mm01_00188882 predicted 278
4 SASI_Mm01_00188883 predicted 516
5 SASI_Mm01_00188884 predicted 603
6 SASI_Mm02_00335393 predicted 398
7 SASI_Mm01_00188886 predicted 320
8 SASI_Mm01_00188887 predicted 549
9 SASI_Mm01_00188888 predicted 555
10 SASI_Mm02_00335394 predicted 878
11 SASI_Mm01_00188880 predicted 786
12 SASI_Mm01_00188885 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029465
CLEC4G MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member G
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029465.1-1028s1c1
Sequence:CCGGGCTCTAACTCACAAGACAGTTCTCGAGAACTGTCTTGTGAGTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-692s1c1
Sequence:CCGGCGCCACCTCAACAAGATTCAACTCGAGTTGAATCTTGTTGAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-770s1c1
Sequence:CCGGCCCAATGATTCCAGAGGACATCTCGAGATGTCCTCTGGAATCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-523s1c1
Sequence:CCGGCCAAGGTTCCTGCTACTATTTCTCGAGAAATAGTAGCAGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-326s1c1
Sequence:CCGGGCGGAGTTTAAGGACATACAACTCGAGTTGTATGTCCTTAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029465
CLEC4G MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member G
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029465.1-1028s1c1
Sequence:CCGGGCTCTAACTCACAAGACAGTTCTCGAGAACTGTCTTGTGAGTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-692s1c1
Sequence:CCGGCGCCACCTCAACAAGATTCAACTCGAGTTGAATCTTGTTGAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-770s1c1
Sequence:CCGGCCCAATGATTCCAGAGGACATCTCGAGATGTCCTCTGGAATCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-523s1c1
Sequence:CCGGCCAAGGTTCCTGCTACTATTTCTCGAGAAATAGTAGCAGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-326s1c1
Sequence:CCGGGCGGAGTTTAAGGACATACAACTCGAGTTGTATGTCCTTAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029465
CLEC4G MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member G
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029465.1-1028s1c1
Sequence:CCGGGCTCTAACTCACAAGACAGTTCTCGAGAACTGTCTTGTGAGTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-692s1c1
Sequence:CCGGCGCCACCTCAACAAGATTCAACTCGAGTTGAATCTTGTTGAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-770s1c1
Sequence:CCGGCCCAATGATTCCAGAGGACATCTCGAGATGTCCTCTGGAATCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-523s1c1
Sequence:CCGGCCAAGGTTCCTGCTACTATTTCTCGAGAAATAGTAGCAGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029465.1-326s1c1
Sequence:CCGGGCGGAGTTTAAGGACATACAACTCGAGTTGTATGTCCTTAAACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198492
CLEC4G MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member G
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-202s1c1
Sequence:CCGGGCTGTGATTCTGAGTATCCTACTCGAGTAGGATACTCAGAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-846s1c1
Sequence:CCGGGCGCGAGAACTGTGTCATGATCTCGAGATCATGACACAGTTCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-631s1c1
Sequence:CCGGGCGCAGGATCACTGCGCAGATCTCGAGATCTGCGCAGTGATCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-913s1c1
Sequence:CCGGGACGGCTGGATCTGTGAGAAACTCGAGTTTCTCACAGATCCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-273s1c1
Sequence:CCGGGCTGAGGACAAACGCCTCGAACTCGAGTTCGAGGCGTTTGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198492
CLEC4G MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member G
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-202s1c1
Sequence:CCGGGCTGTGATTCTGAGTATCCTACTCGAGTAGGATACTCAGAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-846s1c1
Sequence:CCGGGCGCGAGAACTGTGTCATGATCTCGAGATCATGACACAGTTCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-631s1c1
Sequence:CCGGGCGCAGGATCACTGCGCAGATCTCGAGATCTGCGCAGTGATCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-913s1c1
Sequence:CCGGGACGGCTGGATCTGTGAGAAACTCGAGTTTCTCACAGATCCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-273s1c1
Sequence:CCGGGCTGAGGACAAACGCCTCGAACTCGAGTTCGAGGCGTTTGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198492
CLEC4G MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member G
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-202s1c1
Sequence:CCGGGCTGTGATTCTGAGTATCCTACTCGAGTAGGATACTCAGAATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-846s1c1
Sequence:CCGGGCGCGAGAACTGTGTCATGATCTCGAGATCATGACACAGTTCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-631s1c1
Sequence:CCGGGCGCAGGATCACTGCGCAGATCTCGAGATCTGCGCAGTGATCCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-913s1c1
Sequence:CCGGGACGGCTGGATCTGTGAGAAACTCGAGTTTCTCACAGATCCAGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198492.1-273s1c1
Sequence:CCGGGCTGAGGACAAACGCCTCGAACTCGAGTTCGAGGCGTTTGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks