EMAIL THIS PAGE TO A FRIEND

CLEC4M

C-type lectin domain family 4, member M

179 Gene Product Result for
Synonyms: CD209L CD299 DC-SIGN2 DC-SIGNR DCSIGNR HP10347 L-SIGN LSIGN
Gene ID:
Human(10332) Summary: This gene encodes a transmembrane receptor and is often referred to as L-SIGN because of its expression in the endothelial cells of the lymph nodes and liver. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses, with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are common and have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 30835; often referred to as DC-SIGN or CD209). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
Rat(363856) C-type lectin domain family 4, member M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014257 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122831 MISSION® esiRNA esiRNA human CLEC4M (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014257 Rosetta Predictions human pricing
NM_214675 Rosetta Predictions human pricing
NM_214676 Rosetta Predictions human pricing
NM_214677 Rosetta Predictions human pricing
NM_214678 Rosetta Predictions human pricing
NM_214679 Rosetta Predictions human pricing
NM_001108849 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142971 predicted 264
2 SASI_Hs01_00142972 predicted 316
3 SASI_Hs01_00142973 predicted 310
4 SASI_Hs01_00142970 predicted 271
5 SASI_Hs01_00142974 predicted 1156
6 SASI_Hs01_00142975 predicted 1144
7 SASI_Hs01_00142976 predicted 826
8 SASI_Hs01_00142977 predicted 1201
9 SASI_Hs01_00142978 predicted 169
10 SASI_Hs02_00345316 predicted 1322
11 SASI_Hs01_00142979 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210654 predicted 264
2 SASI_Hs01_00210655 predicted 313
3 SASI_Hs01_00210656 predicted 313
4 SASI_Hs01_00210653 predicted 271
5 SASI_Hs01_00210657 predicted 1163
6 SASI_Hs01_00210658 predicted 1149
7 SASI_Hs01_00210659 predicted 832
8 SASI_Hs01_00210660 predicted 1208
9 SASI_Hs01_00210661 predicted 170
10 SASI_Hs02_00374375 predicted 156
11 SASI_Hs01_00210662 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049695 predicted 264
2 SASI_Hs01_00049696 predicted 322
3 SASI_Hs01_00049697 predicted 305
4 SASI_Hs01_00049694 predicted 266
5 SASI_Hs01_00049698 predicted 1088
6 SASI_Hs01_00049699 predicted 1072
7 SASI_Hs01_00049700 predicted 764
8 SASI_Hs01_00049701 predicted 1140
9 SASI_Hs01_00049702 predicted 170
10 SASI_Hs02_00374376 predicted 1252
11 SASI_Hs01_00049703 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374377 predicted 1185
2 SASI_Hs01_00084369 predicted 1049
3 SASI_Hs01_00084370 predicted 172
4 SASI_Hs01_00084372 predicted 832
5 SASI_Hs01_00084373 predicted 1059
6 SASI_Hs01_00084374 predicted 1252
7 SASI_Hs02_00374378 predicted 1318
8 SASI_Hs02_00374379 predicted 1227
9 SASI_Hs02_00374380 predicted 1046
10 SASI_Hs02_00374381 predicted 842
11 SASI_Hs01_00084371 predicted 1246
12 SASI_Hs01_00084375 predicted 167
13 SASI_Hs01_00084376 predicted 165
14 SASI_Hs01_00084377 predicted 129
15 SASI_Hs01_00084378 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374382 predicted 1181
2 SASI_Hs01_00024210 predicted 1044
3 SASI_Hs01_00024211 predicted 168
4 SASI_Hs01_00024213 predicted 830
5 SASI_Hs01_00024214 predicted 1058
6 SASI_Hs01_00024215 predicted 1245
7 SASI_Hs02_00374383 predicted 1317
8 SASI_Hs02_00374384 predicted 1222
9 SASI_Hs02_00374385 predicted 1048
10 SASI_Hs02_00374386 predicted 846
11 SASI_Hs01_00024212 predicted 1246
12 SASI_Hs01_00024216 predicted 157
13 SASI_Hs01_00024217 predicted 157
14 SASI_Hs01_00024218 predicted 124
15 SASI_Hs01_00024219 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042242 predicted 169
2 SASI_Hs02_00374387 predicted 1117
3 SASI_Hs01_00042243 predicted 981
4 SASI_Hs01_00042245 predicted 765
5 SASI_Hs01_00042246 predicted 999
6 SASI_Hs01_00042247 predicted 1184
7 SASI_Hs02_00374388 predicted 1253
8 SASI_Hs02_00374389 predicted 1158
9 SASI_Hs02_00374390 predicted 984
10 SASI_Hs02_00374391 predicted 787
11 SASI_Hs01_00042244 predicted 1186
12 SASI_Hs01_00042248 predicted 161
13 SASI_Hs01_00042249 predicted 156
14 SASI_Hs01_00042250 predicted 130
15 SASI_Hs01_00042251 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242685 predicted 485
2 SASI_Rn02_00242686 predicted 578
3 SASI_Rn02_00242687 predicted 274
4 SASI_Rn02_00242688 predicted 671
5 SASI_Rn02_00242689 predicted 315
6 SASI_Rn02_00242690 predicted 639
7 SASI_Rn02_00242691 predicted 570
8 SASI_Rn02_00242692 predicted 662
9 SASI_Rn02_00242693 predicted 630
10 SASI_Rn02_00242694 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014257
CLEC4M MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 4, member M
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-1147s1c1
Sequence:CCGGGAACCCAACAATAGCGGGAATCTCGAGATTCCCGCTATTGTTGGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-160s1c1
Sequence:CCGGGACTTTCAATTCCAGCAGATACTCGAGTATCTGCTGGAATTGAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-821s1c1
Sequence:CCGGTCTATCAAGAACTGACCGATTCTCGAGAATCGGTCAGTTCTTGATAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-1164s1c1
Sequence:CCGGGAATGAAGACTGTGCGGAATTCTCGAGAATTCCGCACAGTCTTCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-1251s1c1
Sequence:CCGGAGCCTGCTTCAGAGACGAATACTCGAGTATTCGTCTCTGAAGCAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014257.4-1423s21c1
Sequence:CCGGAGACGGTTCTCTGTTCGATTTCTCGAGAAATCGAACAGAGAACCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014257.4-1546s21c1
Sequence:CCGGGACCTGAGTGGGATGCATTTACTCGAGTAAATGCATCCCACTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014257.4-367s21c1
Sequence:CCGGATCCGAGCAAGACGCAATCTACTCGAGTAGATTGCGTCTTGCTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014257.4-1254s21c1
Sequence:CCGGATCGATGTGACGTTGACAATTCTCGAGAATTGTCAACGTCACATCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014257
CLEC4M MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 4, member M
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-1147s1c1
Sequence:CCGGGAACCCAACAATAGCGGGAATCTCGAGATTCCCGCTATTGTTGGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-160s1c1
Sequence:CCGGGACTTTCAATTCCAGCAGATACTCGAGTATCTGCTGGAATTGAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-821s1c1
Sequence:CCGGTCTATCAAGAACTGACCGATTCTCGAGAATCGGTCAGTTCTTGATAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-1164s1c1
Sequence:CCGGGAATGAAGACTGTGCGGAATTCTCGAGAATTCCGCACAGTCTTCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-1251s1c1
Sequence:CCGGAGCCTGCTTCAGAGACGAATACTCGAGTATTCGTCTCTGAAGCAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014257.4-1423s21c1
Sequence:CCGGAGACGGTTCTCTGTTCGATTTCTCGAGAAATCGAACAGAGAACCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014257.4-1546s21c1
Sequence:CCGGGACCTGAGTGGGATGCATTTACTCGAGTAAATGCATCCCACTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014257.4-367s21c1
Sequence:CCGGATCCGAGCAAGACGCAATCTACTCGAGTAGATTGCGTCTTGCTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014257.4-1254s21c1
Sequence:CCGGATCGATGTGACGTTGACAATTCTCGAGAATTGTCAACGTCACATCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014257
CLEC4M MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 4, member M
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-1147s1c1
Sequence:CCGGGAACCCAACAATAGCGGGAATCTCGAGATTCCCGCTATTGTTGGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-160s1c1
Sequence:CCGGGACTTTCAATTCCAGCAGATACTCGAGTATCTGCTGGAATTGAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-821s1c1
Sequence:CCGGTCTATCAAGAACTGACCGATTCTCGAGAATCGGTCAGTTCTTGATAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-1164s1c1
Sequence:CCGGGAATGAAGACTGTGCGGAATTCTCGAGAATTCCGCACAGTCTTCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014257.3-1251s1c1
Sequence:CCGGAGCCTGCTTCAGAGACGAATACTCGAGTATTCGTCTCTGAAGCAGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014257.4-1423s21c1
Sequence:CCGGAGACGGTTCTCTGTTCGATTTCTCGAGAAATCGAACAGAGAACCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014257.4-1546s21c1
Sequence:CCGGGACCTGAGTGGGATGCATTTACTCGAGTAAATGCATCCCACTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014257.4-367s21c1
Sequence:CCGGATCCGAGCAAGACGCAATCTACTCGAGTAGATTGCGTCTTGCTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014257.4-1254s21c1
Sequence:CCGGATCGATGTGACGTTGACAATTCTCGAGAATTGTCAACGTCACATCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks