EMAIL THIS PAGE TO A FRIEND

CLEC5A

C-type lectin domain family 5, member A

226 Gene Product Result for
Synonyms: CLECSF5 MDL-1 MDL1
UniProtKB ID: Q9NY25, Q52M11, Q9UKQ0
Gene ID:
Human(23601) Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein interacts with dnax-activation protein 12 and may play a role in cell activation. Alternative splice variants have been described but their full-length sequence has not been determined. [provided by RefSeq, Jul 2008]
Mouse(23845) C-type lectin domain family 5, member a
Rat(679787) C-type lectin domain family 5, member A
sheep(101111012) C-type lectin domain family 5, member A
domestic guinea pig(100715256) C-type lectin domain family 5, member A
naked mole-rat(101710336) C-type lectin domain family 5, member A
cow(615201) C-type lectin domain family 5, member A
domestic cat(101084436) C-type lectin domain family 5, member A
dog(609161) C-type lectin domain family 5, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400464 Anti-CLEC5A antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB2107679 Anti-CLEC5A antibody produced in rabbit affinity isolated antibody human, horse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013252 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143101 MISSION® esiRNA esiRNA human CLEC5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013252 Rosetta Predictions human pricing
NM_001109377 Rosetta Predictions rat pricing
NM_001038604 Rosetta Predictions mouse pricing
NM_021364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088714 predicted 584
2 SASI_Hs01_00088715 predicted 627
3 SASI_Hs01_00088716 predicted 691
4 SASI_Hs01_00088718 predicted 216
5 SASI_Hs01_00088719 predicted 503
6 SASI_Hs01_00088720 predicted 777
7 SASI_Hs01_00088721 predicted 611
8 SASI_Hs01_00088722 predicted 650
9 SASI_Hs01_00088723 predicted 204
10 SASI_Hs02_00344465 predicted 229
11 SASI_Hs01_00088717 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247816 predicted 786
2 SASI_Rn02_00247817 predicted 287
3 SASI_Rn02_00247818 predicted 851
4 SASI_Rn02_00247819 predicted 767
5 SASI_Rn02_00247820 predicted 584
6 SASI_Rn02_00247821 predicted 742
7 SASI_Rn02_00247822 predicted 864
8 SASI_Rn02_00247823 predicted 718
9 SASI_Rn02_00247824 predicted 226
10 SASI_Rn02_00247825 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154061 predicted 544
2 SASI_Mm01_00154062 predicted 817
3 SASI_Mm01_00154063 predicted 680
4 SASI_Mm01_00154064 predicted 725
5 SASI_Mm01_00154065 predicted 783
6 SASI_Mm01_00154066 predicted 727
7 SASI_Mm01_00154067 predicted 822
8 SASI_Mm01_00154068 predicted 941
9 SASI_Mm02_00289617 predicted 983
10 SASI_Mm02_00289618 predicted 881
11 SASI_Mm01_00154060 predicted 793
12 SASI_Mm01_00154069 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085672 predicted 469
2 SASI_Mm01_00085673 predicted 739
3 SASI_Mm01_00085674 predicted 609
4 SASI_Mm01_00085675 predicted 651
5 SASI_Mm01_00085676 predicted 712
6 SASI_Mm01_00085677 predicted 654
7 SASI_Mm01_00085678 predicted 742
8 SASI_Mm01_00085679 predicted 862
9 SASI_Mm02_00325952 predicted 903
10 SASI_Mm02_00325953 predicted 807
11 SASI_Mm01_00085671 predicted 716
12 SASI_Mm01_00085680 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021364
CLEC5A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 5, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-444s1c1
Sequence:CCGGGCTGGTATTGAGAATTACTTTCTCGAGAAAGTAATTCTCAATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-618s1c1
Sequence:CCGGCGCTGGATCTGCGAAATGAATCTCGAGATTCATTTCGCAGATCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-597s1c1
Sequence:CCGGGCATCATGTGAAGTCAGCTATCTCGAGATAGCTGACTTCACATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-423s1c1
Sequence:CCGGCTGAAGTATCTTCAGGACATACTCGAGTATGTCCTGAAGATACTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-351s1c1
Sequence:CCGGCCTTGGAAAGACAGCATGGATCTCGAGATCCATGCTGTCTTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021364
CLEC5A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 5, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-444s1c1
Sequence:CCGGGCTGGTATTGAGAATTACTTTCTCGAGAAAGTAATTCTCAATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-618s1c1
Sequence:CCGGCGCTGGATCTGCGAAATGAATCTCGAGATTCATTTCGCAGATCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-597s1c1
Sequence:CCGGGCATCATGTGAAGTCAGCTATCTCGAGATAGCTGACTTCACATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-423s1c1
Sequence:CCGGCTGAAGTATCTTCAGGACATACTCGAGTATGTCCTGAAGATACTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-351s1c1
Sequence:CCGGCCTTGGAAAGACAGCATGGATCTCGAGATCCATGCTGTCTTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021364
CLEC5A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 5, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-444s1c1
Sequence:CCGGGCTGGTATTGAGAATTACTTTCTCGAGAAAGTAATTCTCAATACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-618s1c1
Sequence:CCGGCGCTGGATCTGCGAAATGAATCTCGAGATTCATTTCGCAGATCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-597s1c1
Sequence:CCGGGCATCATGTGAAGTCAGCTATCTCGAGATAGCTGACTTCACATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-423s1c1
Sequence:CCGGCTGAAGTATCTTCAGGACATACTCGAGTATGTCCTGAAGATACTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021364.1-351s1c1
Sequence:CCGGCCTTGGAAAGACAGCATGGATCTCGAGATCCATGCTGTCTTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013252
CLEC5A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 5, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013252.2-1777s1c1
Sequence:CCGGGCACGGAATAAGCACATAGTACTCGAGTACTATGTGCTTATTCCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-246s1c1
Sequence:CCGGGTTGTTGGAATGACCTTATTTCTCGAGAAATAAGGTCATTCCAACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-686s1c1
Sequence:CCGGCATTGGCCTAACAAAGACATTCTCGAGAATGTCTTTGTTAGGCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-370s1c1
Sequence:CCGGCCAACGGCTTCATTACCACAACTCGAGTTGTGGTAATGAAGCCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-634s1c1
Sequence:CCGGCTGTGTTCAATGGCAATGTTACTCGAGTAACATTGCCATTGAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013252
CLEC5A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 5, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013252.2-1777s1c1
Sequence:CCGGGCACGGAATAAGCACATAGTACTCGAGTACTATGTGCTTATTCCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-246s1c1
Sequence:CCGGGTTGTTGGAATGACCTTATTTCTCGAGAAATAAGGTCATTCCAACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-686s1c1
Sequence:CCGGCATTGGCCTAACAAAGACATTCTCGAGAATGTCTTTGTTAGGCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-370s1c1
Sequence:CCGGCCAACGGCTTCATTACCACAACTCGAGTTGTGGTAATGAAGCCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-634s1c1
Sequence:CCGGCTGTGTTCAATGGCAATGTTACTCGAGTAACATTGCCATTGAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013252
CLEC5A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 5, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013252.2-1777s1c1
Sequence:CCGGGCACGGAATAAGCACATAGTACTCGAGTACTATGTGCTTATTCCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-246s1c1
Sequence:CCGGGTTGTTGGAATGACCTTATTTCTCGAGAAATAAGGTCATTCCAACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-686s1c1
Sequence:CCGGCATTGGCCTAACAAAGACATTCTCGAGAATGTCTTTGTTAGGCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-370s1c1
Sequence:CCGGCCAACGGCTTCATTACCACAACTCGAGTTGTGGTAATGAAGCCGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013252.2-634s1c1
Sequence:CCGGCTGTGTTCAATGGCAATGTTACTCGAGTAACATTGCCATTGAACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)