EMAIL THIS PAGE TO A FRIEND

CLEC6A

C-type lectin domain family 6, member A

30 Gene Product Result for
Synonyms: CLEC4N CLECSF10
UniProtKB ID: Q6EIG7, A2RUK3
Gene ID:
Human(93978) Summary: Like dectin-1 (CLEC7A; MIM 606264), CLEC6A, or dectin-2, is a type II membrane receptor with an extracellular C-type lectin-like domain fold. However, unlike dectin-1, dectin-2 lacks an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain (Kanazawa et al., 2004 [PubMed 15175046]
cow(514979) C-type lectin domain family 6, member A
naked mole-rat(101720297) C-type lectin domain family 6, member A
domestic guinea pig(101788417) C-type lectin domain family 6, member A
sheep(678675) C-type lectin domain family 6, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007033 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007033 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305181 predicted 269
2 SASI_Hs01_00144417 predicted 269
3 SASI_Hs02_00305182 predicted 209
4 SASI_Hs02_00305183 predicted 298
5 SASI_Hs02_00305184 predicted 275
6 SASI_Hs02_00305185 predicted 271
7 SASI_Hs01_00144424 predicted 276
8 SASI_Hs02_00305186 predicted 198
9 SASI_Hs02_00305187 predicted 286
10 SASI_Hs02_00305188 predicted 302
11 SASI_Hs01_00144418 predicted 412
12 SASI_Hs01_00144419 predicted 540
13 SASI_Hs01_00144420 predicted 450
14 SASI_Hs01_00144421 predicted 703
15 SASI_Hs01_00144422 predicted 645
16 SASI_Hs01_00144423 predicted 570
17 SASI_Hs01_00144425 predicted 676
18 SASI_Hs01_00144426 predicted 687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007033
CLEC6A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 6, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-499s1c1
Sequence:CCGGCAGCAGCTGAATGAGTCATTTCTCGAGAAATGACTCATTCAGCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-358s1c1
Sequence:CCGGGCTTCTTGGAAGTCATTTGGTCTCGAGACCAAATGACTTCCAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-276s1c1
Sequence:CCGGGCTGTCTGAACTACACTCATACTCGAGTATGAGTGTAGTTCAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-634s1c1
Sequence:CCGGGCAGAGCAATGTGCTTCAATACTCGAGTATTGAAGCACATTGCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007033.1-955s1c1
Sequence:CCGGCCTTCCTCTCTTTGTTCCATTCTCGAGAATGGAACAAAGAGAGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007033
CLEC6A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 6, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-499s1c1
Sequence:CCGGCAGCAGCTGAATGAGTCATTTCTCGAGAAATGACTCATTCAGCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-358s1c1
Sequence:CCGGGCTTCTTGGAAGTCATTTGGTCTCGAGACCAAATGACTTCCAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-276s1c1
Sequence:CCGGGCTGTCTGAACTACACTCATACTCGAGTATGAGTGTAGTTCAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-634s1c1
Sequence:CCGGGCAGAGCAATGTGCTTCAATACTCGAGTATTGAAGCACATTGCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007033.1-955s1c1
Sequence:CCGGCCTTCCTCTCTTTGTTCCATTCTCGAGAATGGAACAAAGAGAGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007033
CLEC6A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 6, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-499s1c1
Sequence:CCGGCAGCAGCTGAATGAGTCATTTCTCGAGAAATGACTCATTCAGCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-358s1c1
Sequence:CCGGGCTTCTTGGAAGTCATTTGGTCTCGAGACCAAATGACTTCCAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-276s1c1
Sequence:CCGGGCTGTCTGAACTACACTCATACTCGAGTATGAGTGTAGTTCAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007033.1-634s1c1
Sequence:CCGGGCAGAGCAATGTGCTTCAATACTCGAGTATTGAAGCACATTGCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007033.1-955s1c1
Sequence:CCGGCCTTCCTCTCTTTGTTCCATTCTCGAGAATGGAACAAAGAGAGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)