EMAIL THIS PAGE TO A FRIEND

CLEC9A

C-type lectin domain family 9, member A

63 Gene Product Result for
Synonyms: DNGR1 UNQ9341
UniProtKB ID: Q6UXN8, B0ZBM2
Gene ID:
Human(283420) Summary: CLEC9A is a group V C-type lectin-like receptor (CTLR) that functions as an activation receptor and is expressed on myeloid lineage cells (Huysamen et al., 2008 [PubMed 18408006]
Mouse(232414) C-type lectin domain family 9, member a
Rat(502901) C-type lectin domain family 9, member A
dog(611394) C-type lectin domain family 9, member A
domestic cat(101085728) C-type lectin domain family 9, member A
sheep(101119033) C-type lectin domain family 9, member A
naked mole-rat(101706349) C-type lectin domain family 9, member A
domestic guinea pig(100726117) C-type lectin domain family 9, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1376 Human CLEC9A ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207345 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207345 Rosetta Predictions human pricing
NM_001109354 Rosetta Predictions rat pricing
XM_578403 Rosetta Predictions rat pricing
NM_172732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156378 predicted 774
2 SASI_Hs01_00156379 predicted 1097
3 SASI_Hs01_00156380 predicted 952
4 SASI_Hs01_00156381 predicted 1007
5 SASI_Hs01_00156382 predicted 1003
6 SASI_Hs01_00156383 predicted 748
7 SASI_Hs01_00156384 predicted 1044
8 SASI_Hs01_00156385 predicted 973
9 SASI_Hs01_00156386 predicted 798
10 SASI_Hs02_00373902 predicted 696
11 SASI_Hs01_00156377 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247604 predicted 588
2 SASI_Rn02_00247605 predicted 502
3 SASI_Rn02_00247606 predicted 719
4 SASI_Rn02_00247607 predicted 528
5 SASI_Rn02_00247608 predicted 228
6 SASI_Rn02_00247609 predicted 702
7 SASI_Rn02_00247610 predicted 355
8 SASI_Rn02_00247611 predicted 724
9 SASI_Rn02_00247612 predicted 548
10 SASI_Rn02_00247613 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130839 predicted 496
2 SASI_Rn01_00130840 predicted 407
3 SASI_Rn01_00130841 predicted 207
4 SASI_Rn01_00130842 predicted 339
5 SASI_Rn01_00130843 predicted 440
6 SASI_Rn01_00130844 predicted 341
7 SASI_Rn01_00130845 predicted 491
8 SASI_Rn01_00130846 predicted 263
9 SASI_Rn01_00130847 predicted 280
10 SASI_Rn01_00130848 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096348 predicted 700
2 SASI_Mm01_00096350 predicted 731
3 SASI_Mm01_00096351 predicted 560
4 SASI_Mm01_00096352 predicted 516
5 SASI_Mm02_00344542 predicted 305
6 SASI_Mm02_00344543 predicted 670
7 SASI_Mm02_00344544 predicted 821
8 SASI_Mm01_00096354 predicted 872
9 SASI_Mm01_00096355 predicted 606
10 SASI_Mm02_00344545 predicted 839
11 SASI_Mm01_00096347 predicted 867
12 SASI_Mm01_00096349 predicted 1016
13 SASI_Mm01_00096353 predicted 1010
14 SASI_Mm01_00096356 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172732
CLEC9A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 9, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172732.1-1448s1c1
Sequence:CCGGCCTCACAGATATAGAGATTTACTCGAGTAAATCTCTATATCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-906s1c1
Sequence:CCGGGCTACCTGTTACACAAGTGTTCTCGAGAACACTTGTGTAACAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-271s1c1
Sequence:CCGGCCAGGTATCCTCTCTTGTCTTCTCGAGAAGACAAGAGAGGATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-231s1c1
Sequence:CCGGGCTTGTTAGCAACGTCCATTTCTCGAGAAATGGACGTTGCTAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-349s1c1
Sequence:CCGGGCAGAGGAAATACACACTGGACTCGAGTCCAGTGTGTATTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172732
CLEC9A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 9, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172732.1-1448s1c1
Sequence:CCGGCCTCACAGATATAGAGATTTACTCGAGTAAATCTCTATATCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-906s1c1
Sequence:CCGGGCTACCTGTTACACAAGTGTTCTCGAGAACACTTGTGTAACAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-271s1c1
Sequence:CCGGCCAGGTATCCTCTCTTGTCTTCTCGAGAAGACAAGAGAGGATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-231s1c1
Sequence:CCGGGCTTGTTAGCAACGTCCATTTCTCGAGAAATGGACGTTGCTAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-349s1c1
Sequence:CCGGGCAGAGGAAATACACACTGGACTCGAGTCCAGTGTGTATTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172732
CLEC9A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 9, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172732.1-1448s1c1
Sequence:CCGGCCTCACAGATATAGAGATTTACTCGAGTAAATCTCTATATCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-906s1c1
Sequence:CCGGGCTACCTGTTACACAAGTGTTCTCGAGAACACTTGTGTAACAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-271s1c1
Sequence:CCGGCCAGGTATCCTCTCTTGTCTTCTCGAGAAGACAAGAGAGGATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-231s1c1
Sequence:CCGGGCTTGTTAGCAACGTCCATTTCTCGAGAAATGGACGTTGCTAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172732.1-349s1c1
Sequence:CCGGGCAGAGGAAATACACACTGGACTCGAGTCCAGTGTGTATTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207345
CLEC9A MISSION shRNA Bacterial Glycerol Stock
C-type lectin domain family 9, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207345.1-744s1c1
Sequence:CCGGGCATGGGATTATTAACAGCATCTCGAGATGCTGTTAATAATCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207345.1-1464s1c1
Sequence:CCGGCTGGGACTCAATAATACACTTCTCGAGAAGTGTATTATTGAGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207345.1-662s1c1
Sequence:CCGGCCAGACACTTACCAGAAATGTCTCGAGACATTTCTGGTAAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207345.1-1054s1c1
Sequence:CCGGGCTGCTACAAATAGAGAGCAACTCGAGTTGCTCTCTATTTGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207345.2-711s21c1
Sequence:CCGGGCTGTCTTGTGATGGTGATTTCTCGAGAAATCACCATCACAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207345.2-1498s21c1
Sequence:CCGGCACACCGTCCAGATTTCATTTCTCGAGAAATGAAATCTGGACGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207345.2-878s21c1
Sequence:CCGGTGTGCCCTTCAGATGAAATATCTCGAGATATTTCATCTGAAGGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207345.2-982s21c1
Sequence:CCGGTTGTTACTATGTCTCTGAAATCTCGAGATTTCAGAGACATAGTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207345
CLEC9A MISSION shRNA shRNA Plasmid DNA
C-type lectin domain family 9, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207345.1-744s1c1
Sequence:CCGGGCATGGGATTATTAACAGCATCTCGAGATGCTGTTAATAATCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207345.1-1464s1c1
Sequence:CCGGCTGGGACTCAATAATACACTTCTCGAGAAGTGTATTATTGAGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207345.1-662s1c1
Sequence:CCGGCCAGACACTTACCAGAAATGTCTCGAGACATTTCTGGTAAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207345.1-1054s1c1
Sequence:CCGGGCTGCTACAAATAGAGAGCAACTCGAGTTGCTCTCTATTTGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207345.2-711s21c1
Sequence:CCGGGCTGTCTTGTGATGGTGATTTCTCGAGAAATCACCATCACAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207345.2-1498s21c1
Sequence:CCGGCACACCGTCCAGATTTCATTTCTCGAGAAATGAAATCTGGACGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207345.2-878s21c1
Sequence:CCGGTGTGCCCTTCAGATGAAATATCTCGAGATATTTCATCTGAAGGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207345.2-982s21c1
Sequence:CCGGTTGTTACTATGTCTCTGAAATCTCGAGATTTCAGAGACATAGTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207345
CLEC9A MISSION shRNA Lentiviral Transduction Particles
C-type lectin domain family 9, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207345.1-744s1c1
Sequence:CCGGGCATGGGATTATTAACAGCATCTCGAGATGCTGTTAATAATCCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146558    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207345.1-1464s1c1
Sequence:CCGGCTGGGACTCAATAATACACTTCTCGAGAAGTGTATTATTGAGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207345.1-662s1c1
Sequence:CCGGCCAGACACTTACCAGAAATGTCTCGAGACATTTCTGGTAAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207345.1-1054s1c1
Sequence:CCGGGCTGCTACAAATAGAGAGCAACTCGAGTTGCTCTCTATTTGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207345.2-711s21c1
Sequence:CCGGGCTGTCTTGTGATGGTGATTTCTCGAGAAATCACCATCACAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207345.2-1498s21c1
Sequence:CCGGCACACCGTCCAGATTTCATTTCTCGAGAAATGAAATCTGGACGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207345.2-878s21c1
Sequence:CCGGTGTGCCCTTCAGATGAAATATCTCGAGATATTTCATCTGAAGGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207345.2-982s21c1
Sequence:CCGGTTGTTACTATGTCTCTGAAATCTCGAGATTTCAGAGACATAGTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks