EMAIL THIS PAGE TO A FRIEND

CLECL1

C-type lectin-like 1

21 Gene Product Result for
Synonyms: DCAL-1 DCAL1
Species: Human CLECL1(160365), domestic cat CLECL1(101084461)
UniProtKB ID: Q8IZS7
Gene ID:
Human(160365) Summary: This gene encodes a type II transmembrane, C-type lectin-like protein that is highly expressed on dendritic and B cells. This protein may act as a T-cell costimulatory molecule that enhances interleukin-4 production, and maybe involved in the regulation of the immune response. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
domestic cat(101084461) C-type lectin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172004 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172004 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174359 predicted 384
2 SASI_Hs01_00174360 predicted 382
3 SASI_Hs01_00174361 predicted 277
4 SASI_Hs01_00174362 predicted 402
5 SASI_Hs01_00174363 predicted 361
6 SASI_Hs02_00367771 predicted 288
7 SASI_Hs01_00174364 predicted 241
8 SASI_Hs01_00174365 predicted 302
9 SASI_Hs01_00174366 predicted 224
10 SASI_Hs01_00174367 predicted 287
11 SASI_Hs01_00174368 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172004
CLECL1 MISSION shRNA Bacterial Glycerol Stock
C-type lectin-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-243s21c1
Sequence:CCGGAGATGTAGTCTACGCTGACATCTCGAGATGTCAGCGTAGACTACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-43s21c1
Sequence:CCGGTCTGCTACCTTGATTAGTAAGCTCGAGCTTACTAATCAAGGTAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-184s21c1
Sequence:CCGGCCCTTCAGTGGGACATCATTTCTCGAGAAATGATGTCCCACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-475s21c1
Sequence:CCGGATTACTGCTATGGTGAGATTTCTCGAGAAATCTCACCATAGCAGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-339s1c1
Sequence:CCGGCCATAAATCATGTCCTGCCAACTCGAGTTGGCAGGACATGATTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-357s1c1
Sequence:CCGGCAAAGACTGGAAGGTGCATAACTCGAGTTATGCACCTTCCAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-386s1c1
Sequence:CCGGGTTACTGGATTGCTGAAACTACTCGAGTAGTTTCAGCAATCCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-125s1c1
Sequence:CCGGGAAGGAAATTTGCCATCTCAACTCGAGTTGAGATGGCAAATTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172004.2-363s1c1
Sequence:CCGGCTGGAAGGTGCATAAGGGAAACTCGAGTTTCCCTTATGCACCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-295s1c1
Sequence:CCGGGCGTTTCCACTTCAGAGATCTCTCGAGAGATCTCTGAAGTGGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172004
CLECL1 MISSION shRNA shRNA Plasmid DNA
C-type lectin-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-243s21c1
Sequence:CCGGAGATGTAGTCTACGCTGACATCTCGAGATGTCAGCGTAGACTACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-43s21c1
Sequence:CCGGTCTGCTACCTTGATTAGTAAGCTCGAGCTTACTAATCAAGGTAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-184s21c1
Sequence:CCGGCCCTTCAGTGGGACATCATTTCTCGAGAAATGATGTCCCACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-475s21c1
Sequence:CCGGATTACTGCTATGGTGAGATTTCTCGAGAAATCTCACCATAGCAGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-339s1c1
Sequence:CCGGCCATAAATCATGTCCTGCCAACTCGAGTTGGCAGGACATGATTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-357s1c1
Sequence:CCGGCAAAGACTGGAAGGTGCATAACTCGAGTTATGCACCTTCCAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-386s1c1
Sequence:CCGGGTTACTGGATTGCTGAAACTACTCGAGTAGTTTCAGCAATCCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-125s1c1
Sequence:CCGGGAAGGAAATTTGCCATCTCAACTCGAGTTGAGATGGCAAATTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172004.2-363s1c1
Sequence:CCGGCTGGAAGGTGCATAAGGGAAACTCGAGTTTCCCTTATGCACCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-295s1c1
Sequence:CCGGGCGTTTCCACTTCAGAGATCTCTCGAGAGATCTCTGAAGTGGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172004
CLECL1 MISSION shRNA Lentiviral Transduction Particles
C-type lectin-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-243s21c1
Sequence:CCGGAGATGTAGTCTACGCTGACATCTCGAGATGTCAGCGTAGACTACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-43s21c1
Sequence:CCGGTCTGCTACCTTGATTAGTAAGCTCGAGCTTACTAATCAAGGTAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-184s21c1
Sequence:CCGGCCCTTCAGTGGGACATCATTTCTCGAGAAATGATGTCCCACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172004.2-475s21c1
Sequence:CCGGATTACTGCTATGGTGAGATTTCTCGAGAAATCTCACCATAGCAGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-339s1c1
Sequence:CCGGCCATAAATCATGTCCTGCCAACTCGAGTTGGCAGGACATGATTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-357s1c1
Sequence:CCGGCAAAGACTGGAAGGTGCATAACTCGAGTTATGCACCTTCCAGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-386s1c1
Sequence:CCGGGTTACTGGATTGCTGAAACTACTCGAGTAGTTTCAGCAATCCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-125s1c1
Sequence:CCGGGAAGGAAATTTGCCATCTCAACTCGAGTTGAGATGGCAAATTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172004.2-363s1c1
Sequence:CCGGCTGGAAGGTGCATAAGGGAAACTCGAGTTTCCCTTATGCACCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172004.2-295s1c1
Sequence:CCGGGCGTTTCCACTTCAGAGATCTCTCGAGAGATCTCTGAAGTGGAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks