EMAIL THIS PAGE TO A FRIEND

CLGN

calmegin

55 Gene Product Result for
UniProtKB ID: O14967, B3KS90, D3DNY8
Gene ID:
Human(1047) Summary: Calmegin is a testis-specific endoplasmic reticulum chaperone protein. CLGN may play a role in spermatogeneisis and infertility. [provided by RefSeq, Jul 2008]
Mouse(12745) calmegin
Rat(685504) calmegin
sheep(101115069) calmegin
dog(476076) calmegin
chicken(422447) calmegin
cow(504256) calmegin
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004362 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035331 MISSION® esiRNA esiRNA human CLGN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004362 Rosetta Predictions human pricing
NM_001109472 Rosetta Predictions rat pricing
NM_009904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124916 predicted 1291
2 SASI_Hs01_00124917 predicted 266
3 SASI_Hs01_00124918 predicted 1245
4 SASI_Hs01_00124919 predicted 1339
5 SASI_Hs01_00124921 predicted 498
6 SASI_Hs01_00124922 predicted 1885
7 SASI_Hs01_00124923 predicted 1171
8 SASI_Hs01_00124924 predicted 543
9 SASI_Hs01_00124925 predicted 1348
10 SASI_Hs02_00337431 predicted 815
11 SASI_Hs01_00124920 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248737 predicted 932
2 SASI_Rn02_00248738 predicted 455
3 SASI_Rn02_00248739 predicted 899
4 SASI_Rn02_00248740 predicted 470
5 SASI_Rn02_00248741 predicted 406
6 SASI_Rn02_00248742 predicted 741
7 SASI_Rn02_00248743 predicted 1932
8 SASI_Rn02_00248744 predicted 846
9 SASI_Rn02_00248745 predicted 1340
10 SASI_Rn02_00248746 predicted 1911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095151 predicted 278
2 SASI_Mm01_00095152 predicted 1128
3 SASI_Mm01_00095153 predicted 449
4 SASI_Mm01_00095154 predicted 923
5 SASI_Mm01_00095155 predicted 1335
6 SASI_Mm02_00317415 predicted 914
7 SASI_Mm01_00095156 predicted 783
8 SASI_Mm01_00095157 predicted 730
9 SASI_Mm01_00095159 predicted 662
10 SASI_Mm01_00095160 predicted 748
11 SASI_Mm01_00095158 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009904
CLGN MISSION shRNA Bacterial Glycerol Stock
calmegin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1199s1c1
Sequence:CCGGCCCAATCCTAAAGCTGAGAAACTCGAGTTTCTCAGCTTTAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1175s1c1
Sequence:CCGGCTTGATGATGAACCAAAGTTTCTCGAGAAACTTTGGTTCATCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1982s1c1
Sequence:CCGGGATGAGATGAAGGACGCTGATCTCGAGATCAGCGTCCTTCATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1680s1c1
Sequence:CCGGCCGTTGCATTAGTTGCTTCCTCTCGAGAGGAAGCAACTAATGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-392s1c1
Sequence:CCGGCCTCAACCTATAGGAGAAGTACTCGAGTACTTCTCCTATAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009904
CLGN MISSION shRNA shRNA Plasmid DNA
calmegin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1199s1c1
Sequence:CCGGCCCAATCCTAAAGCTGAGAAACTCGAGTTTCTCAGCTTTAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1175s1c1
Sequence:CCGGCTTGATGATGAACCAAAGTTTCTCGAGAAACTTTGGTTCATCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1982s1c1
Sequence:CCGGGATGAGATGAAGGACGCTGATCTCGAGATCAGCGTCCTTCATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1680s1c1
Sequence:CCGGCCGTTGCATTAGTTGCTTCCTCTCGAGAGGAAGCAACTAATGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-392s1c1
Sequence:CCGGCCTCAACCTATAGGAGAAGTACTCGAGTACTTCTCCTATAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009904
CLGN MISSION shRNA Lentiviral Transduction Particles
calmegin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1199s1c1
Sequence:CCGGCCCAATCCTAAAGCTGAGAAACTCGAGTTTCTCAGCTTTAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1175s1c1
Sequence:CCGGCTTGATGATGAACCAAAGTTTCTCGAGAAACTTTGGTTCATCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1982s1c1
Sequence:CCGGGATGAGATGAAGGACGCTGATCTCGAGATCAGCGTCCTTCATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-1680s1c1
Sequence:CCGGCCGTTGCATTAGTTGCTTCCTCTCGAGAGGAAGCAACTAATGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009904.1-392s1c1
Sequence:CCGGCCTCAACCTATAGGAGAAGTACTCGAGTACTTCTCCTATAGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004362
VALIDATED
CLGN MISSION shRNA Bacterial Glycerol Stock
calmegin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004362.1-1892s1c1
Sequence:CCGGGCCGATAAAGTCAGTACGCAACTCGAGTTGCGTACTGACTTTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004362.1-888s1c1
Sequence:CCGGCCTCCCAAAGAAATTGAAGATCTCGAGATCTTCAATTTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004362.1-735s1c1
Sequence:CCGGCCTCCAGATGTAGACCTTAAACTCGAGTTTAAGGTCTACATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004362.1-507s1c1
Sequence:CCGGCCCTTGATAGTTCAATATGAACTCGAGTTCATATTGAACTATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004362.1-1624s1c1
Sequence:CCGGCCGACATATGTATACCACAAACTCGAGTTTGTGGTATACATATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004362
VALIDATED
CLGN MISSION shRNA shRNA Plasmid DNA
calmegin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004362.1-1892s1c1
Sequence:CCGGGCCGATAAAGTCAGTACGCAACTCGAGTTGCGTACTGACTTTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004362.1-888s1c1
Sequence:CCGGCCTCCCAAAGAAATTGAAGATCTCGAGATCTTCAATTTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004362.1-735s1c1
Sequence:CCGGCCTCCAGATGTAGACCTTAAACTCGAGTTTAAGGTCTACATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004362.1-507s1c1
Sequence:CCGGCCCTTGATAGTTCAATATGAACTCGAGTTCATATTGAACTATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004362.1-1624s1c1
Sequence:CCGGCCGACATATGTATACCACAAACTCGAGTTTGTGGTATACATATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004362
VALIDATED
CLGN MISSION shRNA Lentiviral Transduction Particles
calmegin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004362.1-1892s1c1
Sequence:CCGGGCCGATAAAGTCAGTACGCAACTCGAGTTGCGTACTGACTTTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004362.1-888s1c1
Sequence:CCGGCCTCCCAAAGAAATTGAAGATCTCGAGATCTTCAATTTCTTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004362.1-735s1c1
Sequence:CCGGCCTCCAGATGTAGACCTTAAACTCGAGTTTAAGGTCTACATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004362.1-507s1c1
Sequence:CCGGCCCTTGATAGTTCAATATGAACTCGAGTTCATATTGAACTATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004362.1-1624s1c1
Sequence:CCGGCCGACATATGTATACCACAAACTCGAGTTTGTGGTATACATATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks