EMAIL THIS PAGE TO A FRIEND

CLHC1

clathrin heavy chain linker domain containing 1

65 Gene Product Result for
Synonyms: C2orf63
UniProtKB ID: Q8NHS4, B2RDV1, Q53R93, Q8N403
Gene ID:
Mouse(69885) clathrin heavy chain linker domain containing 1
Rat(289865) clathrin heavy chain linker domain containing 1
domestic cat(101092512) clathrin heavy chain linker domain containing 1
cow(517621) clathrin heavy chain linker domain containing 1
dog(481374) clathrin heavy chain linker domain containing 1
naked mole-rat(101711774) clathrin heavy chain linker domain containing 1
domestic guinea pig(100722426) clathrin heavy chain linker domain containing 1
sheep(101123282) clathrin heavy chain linker domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152385 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152385 Rosetta Predictions human pricing
NM_001013877 Rosetta Predictions rat pricing
NM_001081099 Rosetta Predictions mouse pricing
XM_131720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083960 predicted 536
2 SASI_Hs01_00083961 predicted 369
3 SASI_Hs01_00083963 predicted 1599
4 SASI_Hs01_00083964 predicted 521
5 SASI_Hs01_00083965 predicted 2003
6 SASI_Hs01_00083966 predicted 866
7 SASI_Hs01_00083968 predicted 723
8 SASI_Hs02_00366050 predicted 1615
9 SASI_Hs01_00083969 predicted 417
10 SASI_Hs02_00366051 predicted 385
11 SASI_Hs01_00083962 predicted 1997
12 SASI_Hs01_00083967 predicted 1311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043047 predicted 394
2 SASI_Rn01_00043048 predicted 818
3 SASI_Rn01_00043049 predicted 1730
4 SASI_Rn01_00043050 predicted 1065
5 SASI_Rn02_00201144 predicted 1771
6 SASI_Rn01_00043051 predicted 953
7 SASI_Rn01_00043052 predicted 1288
8 SASI_Rn01_00043053 predicted 1300
9 SASI_Rn01_00043054 predicted 1278
10 SASI_Rn01_00043055 predicted 1249
11 SASI_Rn01_00043056 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295171 predicted 993
2 SASI_Mm02_00295172 predicted 843
3 SASI_Mm02_00295173 predicted 702
4 SASI_Mm02_00295174 predicted 772
5 SASI_Mm02_00295175 predicted 776
6 SASI_Mm02_00295176 predicted 912
7 SASI_Mm02_00295177 predicted 614
8 SASI_Mm02_00295178 predicted 375
9 SASI_Mm02_00295179 predicted 298
10 SASI_Mm02_00295180 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230057 predicted 997
2 SASI_Mm01_00230058 predicted 846
3 SASI_Mm01_00230059 predicted 712
4 SASI_Mm01_00230060 predicted 780
5 SASI_Mm01_00230061 predicted 540
6 SASI_Mm01_00230062 predicted 784
7 SASI_Mm01_00230063 predicted 921
8 SASI_Mm01_00230064 predicted 611
9 SASI_Mm01_00230065 predicted 377
10 SASI_Mm01_00230066 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152385
VALIDATED
CLHC1 MISSION shRNA Bacterial Glycerol Stock
clathrin heavy chain linker domain containing 1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152385.1-1290s1c1
Sequence:CCGGGTTATGCAGCAAACAGTCCTACTCGAGTAGGACTGTTTGCTGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-2075s1c1
Sequence:CCGGGCAGTCAACCTAATGGAACATCTCGAGATGTTCCATTAGGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152385.1-1730s1c1
Sequence:CCGGGATGACCTGTTGCAGCTATTACTCGAGTAATAGCTGCAACAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152385.1-1073s1c1
Sequence:CCGGCAGGCACTTAGTTCATGGGTACTCGAGTACCCATGAACTAAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-1729s1c1
Sequence:CCGGCGATGACCTGTTGCAGCTATTCTCGAGAATAGCTGCAACAGGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152385.1-657s1c1
Sequence:CCGGCAGAGCCTACAGCTTTGGTATCTCGAGATACCAAAGCTGTAGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152385.1-530s1c1
Sequence:CCGGGAGCATATCACTGCATACAAACTCGAGTTTGTATGCAGTGATATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-724s1c1
Sequence:CCGGCGAAAGTAATTCCTCGAAGATCTCGAGATCTTCGAGGAATTACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-735s1c1
Sequence:CCGGCCTCGAAGATTCAATCTCAAACTCGAGTTTGAGATTGAATCTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152385.1-604s1c1
Sequence:CCGGGAAAGACCGAAGAACTACATTCTCGAGAATGTAGTTCTTCGGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152385.2-2384s21c1
Sequence:CCGGTAAGCTAATGTCCAGATATATCTCGAGATATATCTGGACATTAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-871s21c1
Sequence:CCGGTCTAGATGCTCTCACTAAATACTCGAGTATTTAGTGAGAGCATCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-1118s21c1
Sequence:CCGGCAAGACTTTGTGGAGCAAATTCTCGAGAATTTGCTCCACAAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152385.2-2131s21c1
Sequence:CCGGGAGCTTGTACAACACCTTATGCTCGAGCATAAGGTGTTGTACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-1960s21c1
Sequence:CCGGGTGGCAAGAAGTGGCAAATATCTCGAGATATTTGCCACTTCTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-375s21c1
Sequence:CCGGCAGTTCTCCCACCTATCATTTCTCGAGAAATGATAGGTGGGAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152385.2-2350s21c1
Sequence:CCGGGTGAAACAGTGTAGGGCATTTCTCGAGAAATGCCCTACACTGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-1462s21c1
Sequence:CCGGAGGAATCAAATGTGGATTATCCTCGAGGATAATCCACATTTGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152385
VALIDATED
CLHC1 MISSION shRNA shRNA Plasmid DNA
clathrin heavy chain linker domain containing 1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152385.1-1290s1c1
Sequence:CCGGGTTATGCAGCAAACAGTCCTACTCGAGTAGGACTGTTTGCTGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-2075s1c1
Sequence:CCGGGCAGTCAACCTAATGGAACATCTCGAGATGTTCCATTAGGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152385.1-1730s1c1
Sequence:CCGGGATGACCTGTTGCAGCTATTACTCGAGTAATAGCTGCAACAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152385.1-1073s1c1
Sequence:CCGGCAGGCACTTAGTTCATGGGTACTCGAGTACCCATGAACTAAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-1729s1c1
Sequence:CCGGCGATGACCTGTTGCAGCTATTCTCGAGAATAGCTGCAACAGGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152385.1-657s1c1
Sequence:CCGGCAGAGCCTACAGCTTTGGTATCTCGAGATACCAAAGCTGTAGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152385.1-530s1c1
Sequence:CCGGGAGCATATCACTGCATACAAACTCGAGTTTGTATGCAGTGATATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-724s1c1
Sequence:CCGGCGAAAGTAATTCCTCGAAGATCTCGAGATCTTCGAGGAATTACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-735s1c1
Sequence:CCGGCCTCGAAGATTCAATCTCAAACTCGAGTTTGAGATTGAATCTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152385.1-604s1c1
Sequence:CCGGGAAAGACCGAAGAACTACATTCTCGAGAATGTAGTTCTTCGGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152385.2-2384s21c1
Sequence:CCGGTAAGCTAATGTCCAGATATATCTCGAGATATATCTGGACATTAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-871s21c1
Sequence:CCGGTCTAGATGCTCTCACTAAATACTCGAGTATTTAGTGAGAGCATCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-1118s21c1
Sequence:CCGGCAAGACTTTGTGGAGCAAATTCTCGAGAATTTGCTCCACAAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152385.2-2131s21c1
Sequence:CCGGGAGCTTGTACAACACCTTATGCTCGAGCATAAGGTGTTGTACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-1960s21c1
Sequence:CCGGGTGGCAAGAAGTGGCAAATATCTCGAGATATTTGCCACTTCTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-375s21c1
Sequence:CCGGCAGTTCTCCCACCTATCATTTCTCGAGAAATGATAGGTGGGAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152385.2-2350s21c1
Sequence:CCGGGTGAAACAGTGTAGGGCATTTCTCGAGAAATGCCCTACACTGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-1462s21c1
Sequence:CCGGAGGAATCAAATGTGGATTATCCTCGAGGATAATCCACATTTGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152385
VALIDATED
CLHC1 MISSION shRNA Lentiviral Transduction Particles
clathrin heavy chain linker domain containing 1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152385.1-1290s1c1
Sequence:CCGGGTTATGCAGCAAACAGTCCTACTCGAGTAGGACTGTTTGCTGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-2075s1c1
Sequence:CCGGGCAGTCAACCTAATGGAACATCTCGAGATGTTCCATTAGGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152385.1-1730s1c1
Sequence:CCGGGATGACCTGTTGCAGCTATTACTCGAGTAATAGCTGCAACAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152385.1-1073s1c1
Sequence:CCGGCAGGCACTTAGTTCATGGGTACTCGAGTACCCATGAACTAAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-1729s1c1
Sequence:CCGGCGATGACCTGTTGCAGCTATTCTCGAGAATAGCTGCAACAGGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152385.1-657s1c1
Sequence:CCGGCAGAGCCTACAGCTTTGGTATCTCGAGATACCAAAGCTGTAGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152385.1-530s1c1
Sequence:CCGGGAGCATATCACTGCATACAAACTCGAGTTTGTATGCAGTGATATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-724s1c1
Sequence:CCGGCGAAAGTAATTCCTCGAAGATCTCGAGATCTTCGAGGAATTACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152385.1-735s1c1
Sequence:CCGGCCTCGAAGATTCAATCTCAAACTCGAGTTTGAGATTGAATCTTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_152385.1-604s1c1
Sequence:CCGGGAAAGACCGAAGAACTACATTCTCGAGAATGTAGTTCTTCGGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152385.2-2384s21c1
Sequence:CCGGTAAGCTAATGTCCAGATATATCTCGAGATATATCTGGACATTAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-871s21c1
Sequence:CCGGTCTAGATGCTCTCACTAAATACTCGAGTATTTAGTGAGAGCATCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-1118s21c1
Sequence:CCGGCAAGACTTTGTGGAGCAAATTCTCGAGAATTTGCTCCACAAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152385.2-2131s21c1
Sequence:CCGGGAGCTTGTACAACACCTTATGCTCGAGCATAAGGTGTTGTACAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-1960s21c1
Sequence:CCGGGTGGCAAGAAGTGGCAAATATCTCGAGATATTTGCCACTTCTTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-375s21c1
Sequence:CCGGCAGTTCTCCCACCTATCATTTCTCGAGAAATGATAGGTGGGAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152385.2-2350s21c1
Sequence:CCGGGTGAAACAGTGTAGGGCATTTCTCGAGAAATGCCCTACACTGTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152385.2-1462s21c1
Sequence:CCGGAGGAATCAAATGTGGATTATCCTCGAGGATAATCCACATTTGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081099
VALIDATED
CLHC1 MISSION shRNA Bacterial Glycerol Stock
clathrin heavy chain linker domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081099.1-542s21c1
Sequence:CCGGTGGGCACTGGAGAGAGTAAAGCTCGAGCTTTACTCTCTCCAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081099.1-1087s21c1
Sequence:CCGGTCTGAGGGTAATCGGGTTATCCTCGAGGATAACCCGATTACCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081099.1-159s21c1
Sequence:CCGGGCGGAAGATGCAGACACATTTCTCGAGAAATGTGTCTGCATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081099.1-845s21c1
Sequence:CCGGCTTGTCCTCTTTCCTTATTTCCTCGAGGAAATAAGGAAAGAGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081099.1-937s21c1
Sequence:CCGGGTCATTGCCCACAACACTAAACTCGAGTTTAGTGTTGTGGGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081099
VALIDATED
CLHC1 MISSION shRNA shRNA Plasmid DNA
clathrin heavy chain linker domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081099.1-542s21c1
Sequence:CCGGTGGGCACTGGAGAGAGTAAAGCTCGAGCTTTACTCTCTCCAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081099.1-1087s21c1
Sequence:CCGGTCTGAGGGTAATCGGGTTATCCTCGAGGATAACCCGATTACCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081099.1-159s21c1
Sequence:CCGGGCGGAAGATGCAGACACATTTCTCGAGAAATGTGTCTGCATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081099.1-845s21c1
Sequence:CCGGCTTGTCCTCTTTCCTTATTTCCTCGAGGAAATAAGGAAAGAGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081099.1-937s21c1
Sequence:CCGGGTCATTGCCCACAACACTAAACTCGAGTTTAGTGTTGTGGGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081099
VALIDATED
CLHC1 MISSION shRNA Lentiviral Transduction Particles
clathrin heavy chain linker domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081099.1-542s21c1
Sequence:CCGGTGGGCACTGGAGAGAGTAAAGCTCGAGCTTTACTCTCTCCAGTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081099.1-1087s21c1
Sequence:CCGGTCTGAGGGTAATCGGGTTATCCTCGAGGATAACCCGATTACCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081099.1-159s21c1
Sequence:CCGGGCGGAAGATGCAGACACATTTCTCGAGAAATGTGTCTGCATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081099.1-845s21c1
Sequence:CCGGCTTGTCCTCTTTCCTTATTTCCTCGAGGAAATAAGGAAAGAGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081099.1-937s21c1
Sequence:CCGGGTCATTGCCCACAACACTAAACTCGAGTTTAGTGTTGTGGGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks