EMAIL THIS PAGE TO A FRIEND

CLIC1

chloride intracellular channel 1

82 Gene Product Result for
Synonyms: G6 NCC27
UniProtKB ID: O00299, Q15089, Q502X1
Gene ID:
Human(1192) Summary: Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 1 is a member of the p64 family; the protein localizes principally to the cell nucleus and exhibits both nuclear and plasma membrane chloride ion channel activity. [provided by RefSeq, Jul 2008]
Mouse(114584) chloride intracellular channel 1
Rat(406864) chloride intracellular channel 1
Zebrafish(324481) chloride intracellular channel 1
dog(474847) chloride intracellular channel 1
cow(515646) chloride intracellular channel 1
domestic cat(101089516) chloride intracellular channel 1
Goat(100860977) chloride intracellular channel 1
sheep(101118140) chloride intracellular channel 1
Domestic Rabbit(100008817) chloride intracellular channel 1
domestic guinea pig(100720450) chloride intracellular channel 1
naked mole-rat(101702172) chloride intracellular channel 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001288 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001288 Rosetta Predictions human pricing
NM_001002807 Rosetta Predictions rat pricing
NM_033444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018755 predicted 363
2 SASI_Hs01_00018756 predicted 373
3 SASI_Hs01_00018757 predicted 801
4 SASI_Hs01_00018759 predicted 875
5 SASI_Hs01_00018760 predicted 335
6 SASI_Hs01_00018763 predicted 583
7 SASI_Hs01_00018764 predicted 806
8 SASI_Hs02_00331546 predicted 789
9 SASI_Hs02_00331547 predicted 738
10 SASI_Hs02_00331548 predicted 455
11 SASI_Hs01_00018758 predicted 824
12 SASI_Hs01_00018761 predicted 606
13 SASI_Hs01_00018762 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101534 predicted 916
2 SASI_Rn01_00101535 predicted 303
3 SASI_Rn01_00101536 predicted 828
4 SASI_Rn01_00101537 predicted 666
5 SASI_Rn01_00101538 predicted 693
6 SASI_Rn02_00197994 predicted 681
7 SASI_Rn01_00101540 predicted 862
8 SASI_Rn01_00101541 predicted 911
9 SASI_Rn01_00101542 predicted 610
10 SASI_Rn01_00101543 predicted 565
11 SASI_Rn01_00101539 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089125 predicted 833
2 SASI_Mm01_00089126 predicted 673
3 SASI_Mm01_00089127 predicted 318
4 SASI_Mm01_00089128 predicted 786
5 SASI_Mm02_00337350 predicted 307
6 SASI_Mm01_00089129 predicted 832
7 SASI_Mm01_00089130 predicted 805
8 SASI_Mm01_00089131 predicted 840
9 SASI_Mm01_00089132 predicted 841
10 SASI_Mm01_00089133 predicted 520
11 SASI_Mm01_00089134 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001288
VALIDATED
CLIC1 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-718s21c1
Sequence:CCGGGTGGATGAAACCAGTGCTGAACTCGAGTTCAGCACTGGTTTCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-384s21c1
Sequence:CCGGCTTCAATGTTACCACCGTTGACTCGAGTCAACGGTGGTAACATTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-801s21c1
Sequence:CCGGCCTGTTGCCAAAGTTACACATCTCGAGATGTGTAACTTTGGCAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-490s21c1
Sequence:CCGGGACACCAACAAGATTGAGGAACTCGAGTTCCTCAATCTTGTTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001288.4-585s1c1
Sequence:CCGGGCTGGACATATTTGCCAAATTCTCGAGAATTTGGCAAATATGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001288.4-384s1c1
Sequence:CCGGCTTCAATGTTACCACCGTTGACTCGAGTCAACGGTGGTAACATTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001288.4-630s1c1
Sequence:CCGGCCCAGCACTCAATGACAATCTCTCGAGAGATTGTCATTGAGTGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001288.4-880s1c1
Sequence:CCGGGTGCATCGGTACTTGAGCAATCTCGAGATTGCTCAAGTACCGATGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001288.4-718s1c1
Sequence:CCGGGTGGATGAAACCAGTGCTGAACTCGAGTTCAGCACTGGTTTCATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001288.4-490s1c1
Sequence:CCGGGACACCAACAAGATTGAGGAACTCGAGTTCCTCAATCTTGTTGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001288.4-801s1c1
Sequence:CCGGCCTGTTGCCAAAGTTACACATCTCGAGATGTGTAACTTTGGCAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001288.4-484s1c1
Sequence:CCGGCACACAGACACCAACAAGATTCTCGAGAATCTTGTTGGTGTCTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001288
VALIDATED
CLIC1 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-718s21c1
Sequence:CCGGGTGGATGAAACCAGTGCTGAACTCGAGTTCAGCACTGGTTTCATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-384s21c1
Sequence:CCGGCTTCAATGTTACCACCGTTGACTCGAGTCAACGGTGGTAACATTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-801s21c1
Sequence:CCGGCCTGTTGCCAAAGTTACACATCTCGAGATGTGTAACTTTGGCAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-490s21c1
Sequence:CCGGGACACCAACAAGATTGAGGAACTCGAGTTCCTCAATCTTGTTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001288.4-585s1c1
Sequence:CCGGGCTGGACATATTTGCCAAATTCTCGAGAATTTGGCAAATATGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001288.4-384s1c1
Sequence:CCGGCTTCAATGTTACCACCGTTGACTCGAGTCAACGGTGGTAACATTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001288.4-630s1c1
Sequence:CCGGCCCAGCACTCAATGACAATCTCTCGAGAGATTGTCATTGAGTGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001288.4-880s1c1
Sequence:CCGGGTGCATCGGTACTTGAGCAATCTCGAGATTGCTCAAGTACCGATGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001288.4-718s1c1
Sequence:CCGGGTGGATGAAACCAGTGCTGAACTCGAGTTCAGCACTGGTTTCATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001288.4-490s1c1
Sequence:CCGGGACACCAACAAGATTGAGGAACTCGAGTTCCTCAATCTTGTTGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001288.4-801s1c1
Sequence:CCGGCCTGTTGCCAAAGTTACACATCTCGAGATGTGTAACTTTGGCAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001288.4-484s1c1
Sequence:CCGGCACACAGACACCAACAAGATTCTCGAGAATCTTGTTGGTGTCTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001288
VALIDATED
CLIC1 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-718s21c1
Sequence:CCGGGTGGATGAAACCAGTGCTGAACTCGAGTTCAGCACTGGTTTCATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-384s21c1
Sequence:CCGGCTTCAATGTTACCACCGTTGACTCGAGTCAACGGTGGTAACATTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-801s21c1
Sequence:CCGGCCTGTTGCCAAAGTTACACATCTCGAGATGTGTAACTTTGGCAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001288.4-490s21c1
Sequence:CCGGGACACCAACAAGATTGAGGAACTCGAGTTCCTCAATCTTGTTGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001288.4-585s1c1
Sequence:CCGGGCTGGACATATTTGCCAAATTCTCGAGAATTTGGCAAATATGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001288.4-384s1c1
Sequence:CCGGCTTCAATGTTACCACCGTTGACTCGAGTCAACGGTGGTAACATTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001288.4-630s1c1
Sequence:CCGGCCCAGCACTCAATGACAATCTCTCGAGAGATTGTCATTGAGTGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001288.4-880s1c1
Sequence:CCGGGTGCATCGGTACTTGAGCAATCTCGAGATTGCTCAAGTACCGATGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001288.4-718s1c1
Sequence:CCGGGTGGATGAAACCAGTGCTGAACTCGAGTTCAGCACTGGTTTCATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001288.4-490s1c1
Sequence:CCGGGACACCAACAAGATTGAGGAACTCGAGTTCCTCAATCTTGTTGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001288.4-801s1c1
Sequence:CCGGCCTGTTGCCAAAGTTACACATCTCGAGATGTGTAACTTTGGCAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001288.4-484s1c1
Sequence:CCGGCACACAGACACCAACAAGATTCTCGAGAATCTTGTTGGTGTCTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033444
VALIDATED
CLIC1 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-884s21c1
Sequence:CCGGGAAGAGATAGAGCTAGCCTATCTCGAGATAGGCTAGCTCTATCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-433s21c1
Sequence:CCGGCACCAACAAGATCGAGGAATTCTCGAGAATTCCTCGATCTTGTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033444.2-987s21c1
Sequence:CCGGGCTTCCACGTTGCTGCATAATCTCGAGATTATGCAGCAACGTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-828s21c1
Sequence:CCGGGGTACTTGAGCAACGCTTATGCTCGAGCATAAGCGTTGCTCAAGTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-611s21c1
Sequence:CCGGGCCCTGAAGGTTCTAGACAATCTCGAGATTGTCTAGAACCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-611s1c1
Sequence:CCGGGCCCTGAAGGTTCTAGACAATCTCGAGATTGTCTAGAACCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-884s1c1
Sequence:CCGGGAAGAGATAGAGCTAGCCTATCTCGAGATAGGCTAGCTCTATCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033444.1-754s1c1
Sequence:CCGGGCTTCACATAGTACAGGTGGTCTCGAGACCACCTGTACTATGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-280s1c1
Sequence:CCGGCTTCTCCCAGAGACTGTTCATCTCGAGATGAACAGTCTCTGGGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-433s1c1
Sequence:CCGGCACCAACAAGATCGAGGAATTCTCGAGAATTCCTCGATCTTGTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033444
VALIDATED
CLIC1 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-884s21c1
Sequence:CCGGGAAGAGATAGAGCTAGCCTATCTCGAGATAGGCTAGCTCTATCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-433s21c1
Sequence:CCGGCACCAACAAGATCGAGGAATTCTCGAGAATTCCTCGATCTTGTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033444.2-987s21c1
Sequence:CCGGGCTTCCACGTTGCTGCATAATCTCGAGATTATGCAGCAACGTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-828s21c1
Sequence:CCGGGGTACTTGAGCAACGCTTATGCTCGAGCATAAGCGTTGCTCAAGTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-611s21c1
Sequence:CCGGGCCCTGAAGGTTCTAGACAATCTCGAGATTGTCTAGAACCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-611s1c1
Sequence:CCGGGCCCTGAAGGTTCTAGACAATCTCGAGATTGTCTAGAACCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-884s1c1
Sequence:CCGGGAAGAGATAGAGCTAGCCTATCTCGAGATAGGCTAGCTCTATCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033444.1-754s1c1
Sequence:CCGGGCTTCACATAGTACAGGTGGTCTCGAGACCACCTGTACTATGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-280s1c1
Sequence:CCGGCTTCTCCCAGAGACTGTTCATCTCGAGATGAACAGTCTCTGGGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-433s1c1
Sequence:CCGGCACCAACAAGATCGAGGAATTCTCGAGAATTCCTCGATCTTGTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033444
VALIDATED
CLIC1 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-884s21c1
Sequence:CCGGGAAGAGATAGAGCTAGCCTATCTCGAGATAGGCTAGCTCTATCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-433s21c1
Sequence:CCGGCACCAACAAGATCGAGGAATTCTCGAGAATTCCTCGATCTTGTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033444.2-987s21c1
Sequence:CCGGGCTTCCACGTTGCTGCATAATCTCGAGATTATGCAGCAACGTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-828s21c1
Sequence:CCGGGGTACTTGAGCAACGCTTATGCTCGAGCATAAGCGTTGCTCAAGTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033444.2-611s21c1
Sequence:CCGGGCCCTGAAGGTTCTAGACAATCTCGAGATTGTCTAGAACCTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-611s1c1
Sequence:CCGGGCCCTGAAGGTTCTAGACAATCTCGAGATTGTCTAGAACCTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-884s1c1
Sequence:CCGGGAAGAGATAGAGCTAGCCTATCTCGAGATAGGCTAGCTCTATCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033444.1-754s1c1
Sequence:CCGGGCTTCACATAGTACAGGTGGTCTCGAGACCACCTGTACTATGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-280s1c1
Sequence:CCGGCTTCTCCCAGAGACTGTTCATCTCGAGATGAACAGTCTCTGGGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033444.1-433s1c1
Sequence:CCGGCACCAACAAGATCGAGGAATTCTCGAGAATTCCTCGATCTTGTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)