EMAIL THIS PAGE TO A FRIEND

CLIC1P1

chloride intracellular channel 1 pseudogene 1

Gene Product Result for
Species: Human CLIC1P1(390363)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_495936
CLIC1P1 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 1 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-411s1c1
Sequence:CCGGGATGAAACCAGTGCTGAAGATCTCGAGATCTTCAGCACTGGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-743s1c1
Sequence:CCGGGAAGGGCCTGAGTATTACAGTCTCGAGACTGTAATACTCAGGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-736s1c1
Sequence:CCGGGTGACTGGAAGGGCCTGAGTACTCGAGTACTCAGGCCCTTCCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-724s1c1
Sequence:CCGGCCAAGGCAACAGGTGACTGGACTCGAGTCCAGTCACCTGTTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-437s1c1
Sequence:CCGGCATCTCGCAGAGGAAGTTTCTCTCGAGAGAAACTTCCTCTGCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_495936
CLIC1P1 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 1 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-411s1c1
Sequence:CCGGGATGAAACCAGTGCTGAAGATCTCGAGATCTTCAGCACTGGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-743s1c1
Sequence:CCGGGAAGGGCCTGAGTATTACAGTCTCGAGACTGTAATACTCAGGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-736s1c1
Sequence:CCGGGTGACTGGAAGGGCCTGAGTACTCGAGTACTCAGGCCCTTCCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-724s1c1
Sequence:CCGGCCAAGGCAACAGGTGACTGGACTCGAGTCCAGTCACCTGTTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-437s1c1
Sequence:CCGGCATCTCGCAGAGGAAGTTTCTCTCGAGAGAAACTTCCTCTGCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_495936
CLIC1P1 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 1 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-411s1c1
Sequence:CCGGGATGAAACCAGTGCTGAAGATCTCGAGATCTTCAGCACTGGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-743s1c1
Sequence:CCGGGAAGGGCCTGAGTATTACAGTCTCGAGACTGTAATACTCAGGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-736s1c1
Sequence:CCGGGTGACTGGAAGGGCCTGAGTACTCGAGTACTCAGGCCCTTCCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-724s1c1
Sequence:CCGGCCAAGGCAACAGGTGACTGGACTCGAGTCCAGTCACCTGTTGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495936.1-437s1c1
Sequence:CCGGCATCTCGCAGAGGAAGTTTCTCTCGAGAGAAACTTCCTCTGCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks