EMAIL THIS PAGE TO A FRIEND

CLIC2

chloride intracellular channel 2

Synonyms: CLIC2b MRXS32 XAP121
UniProtKB ID: O15247, A8K9S0, O15174, Q5JT80, Q8TCE3
Gene ID:
Human(1193) Summary: Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 2 is a member of the p64 family; the protein is detected in fetal liver and adult skeletal muscle tissue. This gene maps to the candidate region on chromosome X for incontinentia pigmenti. [provided by RefSeq, Jul 2008]
Rat(294141) chloride intracellular channel 2
Zebrafish(436834) chloride intracellular channel 2
cow(532777) chloride intracellular channel 2
dog(492270) chloride intracellular channel 2
chicken(422178) chloride intracellular channel 2
naked mole-rat(101725073) chloride intracellular channel 2
domestic guinea pig(100731792) chloride intracellular channel 2
sheep(101106057) chloride intracellular channel 2
Domestic Rabbit(100328772) chloride intracellular channel 2
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001289 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091651 MISSION® esiRNA esiRNA human CLIC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001289 Rosetta Predictions human pricing
NM_001009651 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242354 predicted 775
2 SASI_Hs01_00242355 predicted 376
3 SASI_Hs01_00242356 predicted 1010
4 SASI_Hs01_00242357 predicted 781
5 SASI_Hs01_00242360 predicted 965
6 SASI_Hs01_00242361 predicted 790
7 SASI_Hs01_00242362 predicted 865
8 SASI_Hs01_00242363 predicted 850
9 SASI_Hs02_00331549 predicted 420
10 SASI_Hs02_00331550 predicted 1011
11 SASI_Hs01_00242358 predicted 845
12 SASI_Hs01_00242359 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078425 predicted 421
2 SASI_Rn01_00078426 predicted 243
3 SASI_Rn02_00199678 predicted 471
4 SASI_Rn01_00078427 predicted 662
5 SASI_Rn01_00078428 predicted 816
6 SASI_Rn01_00078429 predicted 765
7 SASI_Rn01_00078431 predicted 694
8 SASI_Rn01_00078432 predicted 772
9 SASI_Rn01_00078433 predicted 402
10 SASI_Rn01_00078434 predicted 758
11 SASI_Rn01_00078430 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001289
CLIC2 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-810s1c1
Sequence:CCGGGCCAAGAAATATCGTGACTTTCTCGAGAAAGTCACGATATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-719s1c1
Sequence:CCGGCCCAGTTTCCAGAAGACTATTCTCGAGAATAGTCTTCTGGAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-338s1c1
Sequence:CCGGCCTCTGGCTTAAAGGAGTTAACTCGAGTTAACTCCTTTAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-653s1c1
Sequence:CCGGGCGTCTGGATGACTACTTAAACTCGAGTTTAAGTAGTCATCCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-393s1c1
Sequence:CCGGCCTGAAGAACTAAAGGACTTACTCGAGTAAGTCCTTTAGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001289.4-1454s21c1
Sequence:CCGGAGCATATCAGAGAGGCAAATTCTCGAGAATTTGCCTCTCTGATATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001289.4-876s21c1
Sequence:CCGGTCTCAGGAGTCTGGCGTTATCCTCGAGGATAACGCCAGACTCCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001289.4-809s21c1
Sequence:CCGGTTACCCAAGCTGAACATTATTCTCGAGAATAATGTTCAGCTTGGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001289
CLIC2 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-810s1c1
Sequence:CCGGGCCAAGAAATATCGTGACTTTCTCGAGAAAGTCACGATATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-719s1c1
Sequence:CCGGCCCAGTTTCCAGAAGACTATTCTCGAGAATAGTCTTCTGGAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-338s1c1
Sequence:CCGGCCTCTGGCTTAAAGGAGTTAACTCGAGTTAACTCCTTTAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-653s1c1
Sequence:CCGGGCGTCTGGATGACTACTTAAACTCGAGTTTAAGTAGTCATCCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-393s1c1
Sequence:CCGGCCTGAAGAACTAAAGGACTTACTCGAGTAAGTCCTTTAGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001289.4-1454s21c1
Sequence:CCGGAGCATATCAGAGAGGCAAATTCTCGAGAATTTGCCTCTCTGATATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001289.4-876s21c1
Sequence:CCGGTCTCAGGAGTCTGGCGTTATCCTCGAGGATAACGCCAGACTCCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001289.4-809s21c1
Sequence:CCGGTTACCCAAGCTGAACATTATTCTCGAGAATAATGTTCAGCTTGGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001289
CLIC2 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-810s1c1
Sequence:CCGGGCCAAGAAATATCGTGACTTTCTCGAGAAAGTCACGATATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-719s1c1
Sequence:CCGGCCCAGTTTCCAGAAGACTATTCTCGAGAATAGTCTTCTGGAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-338s1c1
Sequence:CCGGCCTCTGGCTTAAAGGAGTTAACTCGAGTTAACTCCTTTAAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-653s1c1
Sequence:CCGGGCGTCTGGATGACTACTTAAACTCGAGTTTAAGTAGTCATCCAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001289.3-393s1c1
Sequence:CCGGCCTGAAGAACTAAAGGACTTACTCGAGTAAGTCCTTTAGTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001289.4-1454s21c1
Sequence:CCGGAGCATATCAGAGAGGCAAATTCTCGAGAATTTGCCTCTCTGATATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001289.4-876s21c1
Sequence:CCGGTCTCAGGAGTCTGGCGTTATCCTCGAGGATAACGCCAGACTCCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001289.4-809s21c1
Sequence:CCGGTTACCCAAGCTGAACATTATTCTCGAGAATAATGTTCAGCTTGGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks