EMAIL THIS PAGE TO A FRIEND

CLIC3

chloride intracellular channel 3

63 Gene Product Result for
UniProtKB ID: O95833, Q5SPZ7
Gene ID:
Human(9022) Summary: Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 3 is a member of the p64 family and is predominantly localized in the nucleus and stimulates chloride ion channel activity. In addition, this protein may participate in cellular growth control, based on its association with ERK7, a member of the MAP kinase family. [provided by RefSeq, Jul 2008]
Mouse(69454) chloride intracellular channel 3
Rat(296566) chloride intracellular channel 3
domestic guinea pig(100732306) chloride intracellular channel 3
naked mole-rat(101699207) chloride intracellular channel 3
chicken(777405) chloride intracellular channel 3
cow(505436) chloride intracellular channel 3
domestic cat(101099845) chloride intracellular channel 3
dog(607042) chloride intracellular channel 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004669 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027085 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027085 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027085 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU062681 MISSION® esiRNA esiRNA targeting mouse Clic3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004669 Rosetta Predictions human pricing
NM_001013080 Rosetta Predictions rat pricing
NM_027085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217432 predicted 315
2 SASI_Hs01_00217434 predicted 354
3 SASI_Hs01_00217435 predicted 570
4 SASI_Hs02_00338094 predicted 377
5 SASI_Hs01_00217436 predicted 244
6 SASI_Hs02_00338095 predicted 205
7 SASI_Hs01_00217437 predicted 334
8 SASI_Hs01_00217438 predicted 531
9 SASI_Hs01_00217440 predicted 206
10 SASI_Hs01_00217441 predicted 572
11 SASI_Hs01_00217433 predicted 516
12 SASI_Hs01_00217439 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115610 predicted 420
2 SASI_Rn01_00115615 predicted 229
3 SASI_Rn02_00200712 predicted 511
4 SASI_Rn01_00115618 predicted 291
5 SASI_Rn02_00200713 predicted 226
6 SASI_Rn02_00200714 predicted 539
7 SASI_Rn02_00200715 predicted 552
8 SASI_Rn02_00200716 predicted 508
9 SASI_Rn02_00200717 predicted 327
10 SASI_Rn02_00200718 predicted 437
11 SASI_Rn01_00115611 predicted 701
12 SASI_Rn01_00115612 predicted 565
13 SASI_Rn01_00115613 predicted 379
14 SASI_Rn01_00115614 predicted 425
15 SASI_Rn01_00115616 predicted 359
16 SASI_Rn01_00115617 predicted 536
17 SASI_Rn01_00115619 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105932 predicted 452
2 SASI_Mm01_00105934 predicted 342
3 SASI_Mm01_00105936 predicted 541
4 SASI_Mm01_00105937 predicted 319
5 SASI_Mm01_00105938 predicted 335
6 SASI_Mm01_00105939 predicted 567
7 SASI_Mm01_00105940 predicted 340
8 SASI_Mm01_00105941 predicted 249
9 SASI_Mm02_00331509 predicted 572
10 SASI_Mm02_00331510 predicted 499
11 SASI_Mm01_00105933 predicted 542
12 SASI_Mm01_00105935 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004669
CLIC3 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004669.2-114s21c1
Sequence:CCGGTTCATGGTCCTGCTCCTCAAGCTCGAGCTTGAGGAGCAGGACCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004669.2-241s21c1
Sequence:CCGGCCAAGACAGACACGCTGCAGACTCGAGTCTGCAGCGTGTCTGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004669.2-252s21c1
Sequence:CCGGACGCTGCAGATCGAGGACTTTCTCGAGAAAGTCCTCGATCTGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-314s1c1
Sequence:CCGGGCCTCGTTACAGGGAGTCCAACTCGAGTTGGACTCCCTGTAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-125s1c1
Sequence:CCGGGCTCCTCAAGGGCGTACCTTTCTCGAGAAAGGTACGCCCTTGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-659s1c1
Sequence:CCGGGCAGGAGAAAGAGTTCAAATACTCGAGTATTTGAACTCTTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-368s1c1
Sequence:CCGGCGCGTTCATCAAGAACCCGGTCTCGAGACCGGGTTCTTGATGAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-224s1c1
Sequence:CCGGGCTCTATGACAGCGACGCCAACTCGAGTTGGCGTCGCTGTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004669
CLIC3 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004669.2-114s21c1
Sequence:CCGGTTCATGGTCCTGCTCCTCAAGCTCGAGCTTGAGGAGCAGGACCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004669.2-241s21c1
Sequence:CCGGCCAAGACAGACACGCTGCAGACTCGAGTCTGCAGCGTGTCTGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004669.2-252s21c1
Sequence:CCGGACGCTGCAGATCGAGGACTTTCTCGAGAAAGTCCTCGATCTGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-314s1c1
Sequence:CCGGGCCTCGTTACAGGGAGTCCAACTCGAGTTGGACTCCCTGTAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-125s1c1
Sequence:CCGGGCTCCTCAAGGGCGTACCTTTCTCGAGAAAGGTACGCCCTTGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-659s1c1
Sequence:CCGGGCAGGAGAAAGAGTTCAAATACTCGAGTATTTGAACTCTTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-368s1c1
Sequence:CCGGCGCGTTCATCAAGAACCCGGTCTCGAGACCGGGTTCTTGATGAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-224s1c1
Sequence:CCGGGCTCTATGACAGCGACGCCAACTCGAGTTGGCGTCGCTGTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004669
CLIC3 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004669.2-114s21c1
Sequence:CCGGTTCATGGTCCTGCTCCTCAAGCTCGAGCTTGAGGAGCAGGACCATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004669.2-241s21c1
Sequence:CCGGCCAAGACAGACACGCTGCAGACTCGAGTCTGCAGCGTGTCTGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004669.2-252s21c1
Sequence:CCGGACGCTGCAGATCGAGGACTTTCTCGAGAAAGTCCTCGATCTGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-314s1c1
Sequence:CCGGGCCTCGTTACAGGGAGTCCAACTCGAGTTGGACTCCCTGTAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-125s1c1
Sequence:CCGGGCTCCTCAAGGGCGTACCTTTCTCGAGAAAGGTACGCCCTTGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-659s1c1
Sequence:CCGGGCAGGAGAAAGAGTTCAAATACTCGAGTATTTGAACTCTTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-368s1c1
Sequence:CCGGCGCGTTCATCAAGAACCCGGTCTCGAGACCGGGTTCTTGATGAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004669.2-224s1c1
Sequence:CCGGGCTCTATGACAGCGACGCCAACTCGAGTTGGCGTCGCTGTCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027085
CLIC3 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027085.3-342s21c1
Sequence:CCGGCAACACAGCGGGCAATGACATCTCGAGATGTCATTGCCCGCTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027085.3-587s21c1
Sequence:CCGGTGGATACCGTGTGTGCACACTCTCGAGAGTGTGCACACACGGTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-368s1c1
Sequence:CCGGCCACAAGTTCTCTGCCTTCATCTCGAGATGAAGGCAGAGAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-405s1c1
Sequence:CCGGACACAGGACAATGCCCTGTATCTCGAGATACAGGGCATTGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-119s1c1
Sequence:CCGGGCGGCTCTTCATGGTCCTACTCTCGAGAGTAGGACCATGAAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-264s1c1
Sequence:CCGGACACTGCAGATCGAGGAGTTTCTCGAGAAACTCCTCGATCTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-567s1c1
Sequence:CCGGCTACTACCCAAGCTGCACATTCTCGAGAATGTGCAGCTTGGGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027085
CLIC3 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027085.3-342s21c1
Sequence:CCGGCAACACAGCGGGCAATGACATCTCGAGATGTCATTGCCCGCTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027085.3-587s21c1
Sequence:CCGGTGGATACCGTGTGTGCACACTCTCGAGAGTGTGCACACACGGTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-368s1c1
Sequence:CCGGCCACAAGTTCTCTGCCTTCATCTCGAGATGAAGGCAGAGAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-405s1c1
Sequence:CCGGACACAGGACAATGCCCTGTATCTCGAGATACAGGGCATTGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-119s1c1
Sequence:CCGGGCGGCTCTTCATGGTCCTACTCTCGAGAGTAGGACCATGAAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-264s1c1
Sequence:CCGGACACTGCAGATCGAGGAGTTTCTCGAGAAACTCCTCGATCTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-567s1c1
Sequence:CCGGCTACTACCCAAGCTGCACATTCTCGAGAATGTGCAGCTTGGGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027085
CLIC3 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027085.3-342s21c1
Sequence:CCGGCAACACAGCGGGCAATGACATCTCGAGATGTCATTGCCCGCTGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027085.3-587s21c1
Sequence:CCGGTGGATACCGTGTGTGCACACTCTCGAGAGTGTGCACACACGGTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-368s1c1
Sequence:CCGGCCACAAGTTCTCTGCCTTCATCTCGAGATGAAGGCAGAGAACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-405s1c1
Sequence:CCGGACACAGGACAATGCCCTGTATCTCGAGATACAGGGCATTGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-119s1c1
Sequence:CCGGGCGGCTCTTCATGGTCCTACTCTCGAGAGTAGGACCATGAAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-264s1c1
Sequence:CCGGACACTGCAGATCGAGGAGTTTCTCGAGAAACTCCTCGATCTGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027085.1-567s1c1
Sequence:CCGGCTACTACCCAAGCTGCACATTCTCGAGAATGTGCAGCTTGGGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks