EMAIL THIS PAGE TO A FRIEND

CLIC4

chloride intracellular channel 4

Synonyms: CLIC4L H1 MTCLIC huH1 p64H1
UniProtKB ID: Q9Y696, Q9UFW9, Q9UQJ6
Gene ID:
Human(25932) Summary: Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 4 (CLIC4) protein, encoded by the CLIC4 gene, is a member of the p64 family; the gene is expressed in many tissues and exhibits a intracellular vesicular pattern in Panc-1 cells (pancreatic cancer cells). [provided by RefSeq, Jul 2008]
Mouse(29876) chloride intracellular channel 4 (mitochondrial)
Rat(83718) chloride intracellular channel 4
Zebrafish(368255) chloride intracellular channel 4
cow(286823) chloride intracellular channel 4
domestic cat(101098476) chloride intracellular channel 4
dog(487367) chloride intracellular channel 4
chicken(419595) chloride intracellular channel 4
naked mole-rat(101725911) chloride intracellular channel 4
domestic guinea pig(100735560) chloride intracellular channel 4
sheep(101115514) chloride intracellular channel 4
212 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013943 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013943 Rosetta Predictions human pricing
NM_031818 Rosetta Predictions rat pricing
NM_013885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344885 predicted 545
2 SASI_Hs01_00122001 predicted 422
3 SASI_Hs02_00344886 predicted 855
4 SASI_Hs02_00344887 predicted 504
5 SASI_Hs02_00344888 predicted 861
6 SASI_Hs02_00344889 predicted 464
7 SASI_Hs01_00122002 predicted 850
8 SASI_Hs01_00122003 predicted 484
9 SASI_Hs01_00122004 predicted 419
10 SASI_Hs02_00344890 predicted 642
11 SASI_Hs01_00122005 predicted 850
12 SASI_Hs01_00122006 predicted 728
13 SASI_Hs01_00122007 predicted 334
14 SASI_Hs01_00122008 predicted 332
15 SASI_Hs01_00122009 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065460 predicted 228
2 SASI_Rn01_00065462 predicted 221
3 SASI_Rn01_00065463 predicted 495
4 SASI_Rn02_00265289 predicted 351
5 SASI_Rn01_00065464 predicted 536
6 SASI_Rn01_00065465 predicted 265
7 SASI_Rn01_00065466 predicted 387
8 SASI_Rn01_00065467 predicted 307
9 SASI_Rn01_00065468 predicted 249
10 SASI_Rn01_00065469 predicted 352
11 SASI_Rn01_00065461 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322912 predicted 405
2 SASI_Mm02_00322913 predicted 791
3 SASI_Mm01_00094374 predicted 999
4 SASI_Mm01_00094375 predicted 533
5 SASI_Mm01_00094376 predicted 527
6 SASI_Mm02_00322914 predicted 960
7 SASI_Mm01_00094378 predicted 471
8 SASI_Mm01_00094379 predicted 425
9 SASI_Mm01_00094380 predicted 516
10 SASI_Mm01_00094381 predicted 559
11 SASI_Mm01_00094372 predicted 1032
12 SASI_Mm01_00094373 predicted 1058
13 SASI_Mm01_00094377 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013885
VALIDATED
CLIC4 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013885.1-391s1c1
Sequence:CCGGCCCGCCATTTATAACCTTCAACTCGAGTTGAAGGTTATAAATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013885.1-470s1c1
Sequence:CCGGCCACCCAAGTACCTAAAGCTTCTCGAGAAGCTTTAGGTACTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013885.1-707s1c1
Sequence:CCGGGACGGCGATGAGATGACATTACTCGAGTAATGTCATCTCATCGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013885.1-785s1c1
Sequence:CCGGCGCAACTTTGATATTCCTAAACTCGAGTTTAGGAATATCAAAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-248s21c1
Sequence:CCGGGAAGTGATGGTGAAAGCATTGCTCGAGCAATGCTTTCACCATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013885.2-621s21c1
Sequence:CCGGACTGGATGAGTACCTCAACTCCTCGAGGAGTTGAGGTACTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-414s21c1
Sequence:CCGGCAGCGAAGTCAAGACGGATGTCTCGAGACATCCGTCTTGACTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-1321s21c1
Sequence:CCGGGTTGCTGTGTGCATGGTATAGCTCGAGCTATACCATGCACACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013885.2-385s21c1
Sequence:CCGGGGGACCCACCCGCCATTTATACTCGAGTATAAATGGCGGGTGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-223s21c1
Sequence:CCGGCTCATCGAGCTCTTCGTCAAGCTCGAGCTTGACGAAGAGCTCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-550s21c1
Sequence:CCGGGCTTACATCAAGAACTCAAGACTCGAGTCTTGAGTTCTTGATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013885
VALIDATED
CLIC4 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013885.1-391s1c1
Sequence:CCGGCCCGCCATTTATAACCTTCAACTCGAGTTGAAGGTTATAAATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013885.1-470s1c1
Sequence:CCGGCCACCCAAGTACCTAAAGCTTCTCGAGAAGCTTTAGGTACTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013885.1-707s1c1
Sequence:CCGGGACGGCGATGAGATGACATTACTCGAGTAATGTCATCTCATCGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013885.1-785s1c1
Sequence:CCGGCGCAACTTTGATATTCCTAAACTCGAGTTTAGGAATATCAAAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-248s21c1
Sequence:CCGGGAAGTGATGGTGAAAGCATTGCTCGAGCAATGCTTTCACCATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013885.2-621s21c1
Sequence:CCGGACTGGATGAGTACCTCAACTCCTCGAGGAGTTGAGGTACTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-414s21c1
Sequence:CCGGCAGCGAAGTCAAGACGGATGTCTCGAGACATCCGTCTTGACTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-1321s21c1
Sequence:CCGGGTTGCTGTGTGCATGGTATAGCTCGAGCTATACCATGCACACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013885.2-385s21c1
Sequence:CCGGGGGACCCACCCGCCATTTATACTCGAGTATAAATGGCGGGTGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-223s21c1
Sequence:CCGGCTCATCGAGCTCTTCGTCAAGCTCGAGCTTGACGAAGAGCTCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-550s21c1
Sequence:CCGGGCTTACATCAAGAACTCAAGACTCGAGTCTTGAGTTCTTGATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013885
VALIDATED
CLIC4 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013885.1-391s1c1
Sequence:CCGGCCCGCCATTTATAACCTTCAACTCGAGTTGAAGGTTATAAATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013885.1-470s1c1
Sequence:CCGGCCACCCAAGTACCTAAAGCTTCTCGAGAAGCTTTAGGTACTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013885.1-707s1c1
Sequence:CCGGGACGGCGATGAGATGACATTACTCGAGTAATGTCATCTCATCGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013885.1-785s1c1
Sequence:CCGGCGCAACTTTGATATTCCTAAACTCGAGTTTAGGAATATCAAAGTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-248s21c1
Sequence:CCGGGAAGTGATGGTGAAAGCATTGCTCGAGCAATGCTTTCACCATCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013885.2-621s21c1
Sequence:CCGGACTGGATGAGTACCTCAACTCCTCGAGGAGTTGAGGTACTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-414s21c1
Sequence:CCGGCAGCGAAGTCAAGACGGATGTCTCGAGACATCCGTCTTGACTTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366378    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-1321s21c1
Sequence:CCGGGTTGCTGTGTGCATGGTATAGCTCGAGCTATACCATGCACACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013885.2-385s21c1
Sequence:CCGGGGGACCCACCCGCCATTTATACTCGAGTATAAATGGCGGGTGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-223s21c1
Sequence:CCGGCTCATCGAGCTCTTCGTCAAGCTCGAGCTTGACGAAGAGCTCGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013885.2-550s21c1
Sequence:CCGGGCTTACATCAAGAACTCAAGACTCGAGTCTTGAGTTCTTGATGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013943
VALIDATED
CLIC4 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-4128s1c1
Sequence:CCGGGCCGTAATGTTGAACAGAATTCTCGAGAATTCTGTTCAACATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013943.1-419s1c1
Sequence:CCGGCCCACCATTTATAACTTTCAACTCGAGTTGAAAGTTATAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-735s1c1
Sequence:CCGGGATGGCAATGAAATGACATTACTCGAGTAATGTCATTTCATTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-900s1c1
Sequence:CCGGCCCAGTGATAAGGAGGTTGAACTCGAGTTCAACCTCCTTATCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-924s1c1
Sequence:CCGGGCATATAGTGATGTAGCCAAACTCGAGTTTGGCTACATCACTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-823s21c1
Sequence:CCGGGATGGCAATGAAATGACATTACTCGAGTAATGTCATTTCATTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-4215s21c1
Sequence:CCGGGCCGTAATGTTGAACAGAATTCTCGAGAATTCTGTTCAACATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-1012s21c1
Sequence:CCGGGCATATAGTGATGTAGCCAAACTCGAGTTTGGCTACATCACTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-581s21c1
Sequence:CCGGTATGCCCTCCCAAGTACTTAACTCGAGTTAAGTACTTGGGAGGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013943
VALIDATED
CLIC4 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-4128s1c1
Sequence:CCGGGCCGTAATGTTGAACAGAATTCTCGAGAATTCTGTTCAACATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013943.1-419s1c1
Sequence:CCGGCCCACCATTTATAACTTTCAACTCGAGTTGAAAGTTATAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-735s1c1
Sequence:CCGGGATGGCAATGAAATGACATTACTCGAGTAATGTCATTTCATTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-900s1c1
Sequence:CCGGCCCAGTGATAAGGAGGTTGAACTCGAGTTCAACCTCCTTATCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-924s1c1
Sequence:CCGGGCATATAGTGATGTAGCCAAACTCGAGTTTGGCTACATCACTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-823s21c1
Sequence:CCGGGATGGCAATGAAATGACATTACTCGAGTAATGTCATTTCATTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-4215s21c1
Sequence:CCGGGCCGTAATGTTGAACAGAATTCTCGAGAATTCTGTTCAACATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-1012s21c1
Sequence:CCGGGCATATAGTGATGTAGCCAAACTCGAGTTTGGCTACATCACTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-581s21c1
Sequence:CCGGTATGCCCTCCCAAGTACTTAACTCGAGTTAAGTACTTGGGAGGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013943
VALIDATED
CLIC4 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-4128s1c1
Sequence:CCGGGCCGTAATGTTGAACAGAATTCTCGAGAATTCTGTTCAACATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013943.1-419s1c1
Sequence:CCGGCCCACCATTTATAACTTTCAACTCGAGTTGAAAGTTATAAATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-735s1c1
Sequence:CCGGGATGGCAATGAAATGACATTACTCGAGTAATGTCATTTCATTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-900s1c1
Sequence:CCGGCCCAGTGATAAGGAGGTTGAACTCGAGTTCAACCTCCTTATCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_013943.1-924s1c1
Sequence:CCGGGCATATAGTGATGTAGCCAAACTCGAGTTTGGCTACATCACTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-823s21c1
Sequence:CCGGGATGGCAATGAAATGACATTACTCGAGTAATGTCATTTCATTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-4215s21c1
Sequence:CCGGGCCGTAATGTTGAACAGAATTCTCGAGAATTCTGTTCAACATTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-1012s21c1
Sequence:CCGGGCATATAGTGATGTAGCCAAACTCGAGTTTGGCTACATCACTATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_013943.2-581s21c1
Sequence:CCGGTATGCCCTCCCAAGTACTTAACTCGAGTTAAGTACTTGGGAGGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks