EMAIL THIS PAGE TO A FRIEND

CLIC6

chloride intracellular channel 6

58 Gene Product Result for
Synonyms: CLIC1L
UniProtKB ID: Q96NY7, A8K0U8, Q8IX31
Gene ID:
Human(54102) Summary: This gene encodes a member of the chloride intracellular channel family of proteins. The gene is part of a large triplicated region found on chromosomes 1, 6, and 21. An alternatively spliced transcript variant has been described, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(209195) chloride intracellular channel 6
Rat(304081) chloride intracellular channel 6
chicken(427981) chloride intracellular channel 6
dog(487745) chloride intracellular channel 6
cow(507243) chloride intracellular channel 6
domestic cat(101085145) chloride intracellular channel 6
naked mole-rat(101713305) chloride intracellular channel 6
domestic guinea pig(100727449) chloride intracellular channel 6
sheep(101108019) chloride intracellular channel 6
Domestic Rabbit(100008620) chloride intracellular channel 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053277 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053277 Rosetta Predictions human pricing
NM_176078 Rosetta Predictions rat pricing
NM_172469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041507 predicted 1946
2 SASI_Hs01_00041508 predicted 2025
3 SASI_Hs01_00041509 predicted 1648
4 SASI_Hs01_00041511 predicted 1572
5 SASI_Hs01_00041512 predicted 1697
6 SASI_Hs01_00041513 predicted 1546
7 SASI_Hs01_00041515 predicted 1352
8 SASI_Hs02_00361910 predicted 1969
9 SASI_Hs02_00361911 predicted 2016
10 SASI_Hs02_00361912 predicted 1628
11 SASI_Hs01_00041510 predicted 1754
12 SASI_Hs01_00041514 predicted 1782
13 SASI_Hs01_00041516 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062373 predicted 1514
2 SASI_Rn01_00062374 predicted 1663
3 SASI_Rn01_00062375 predicted 2022
4 SASI_Rn01_00062376 predicted 1432
5 SASI_Rn01_00062377 predicted 1714
6 SASI_Rn02_00269560 predicted 1937
7 SASI_Rn01_00062378 predicted 1750
8 SASI_Rn01_00062379 predicted 1986
9 SASI_Rn01_00062381 predicted 1529
10 SASI_Rn02_00269561 predicted 1781
11 SASI_Rn01_00062380 predicted 1495
12 SASI_Rn01_00062382 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093778 predicted 1475
2 SASI_Mm01_00093779 predicted 1978
3 SASI_Mm01_00093780 predicted 1902
4 SASI_Mm01_00093781 predicted 1483
5 SASI_Mm01_00093782 predicted 1939
6 SASI_Mm01_00093783 predicted 1705
7 SASI_Mm01_00093784 predicted 2062
8 SASI_Mm01_00093785 predicted 1381
9 SASI_Mm01_00093786 predicted 946
10 SASI_Mm02_00344016 predicted 1833
11 SASI_Mm01_00093787 predicted 1054
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172469
CLIC6 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-2052s1c1
Sequence:CCGGCGGGAGATTGAACACGCATATCTCGAGATATGCGTGTTCAATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-1472s1c1
Sequence:CCGGCCTCTGGCTAAAGGGTGTTATCTCGAGATAACACCCTTTAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-1401s1c1
Sequence:CCGGCTCTTCGTCAAGGCTGGTTATCTCGAGATAACCAGCCTTGACGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-959s1c1
Sequence:CCGGTGAGATTGTAACCACAGAGATCTCGAGATCTCTGTGGTTACAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-1943s1c1
Sequence:CCGGCGCCAAGAAATATAGAGATTTCTCGAGAAATCTCTATATTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172469
CLIC6 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-2052s1c1
Sequence:CCGGCGGGAGATTGAACACGCATATCTCGAGATATGCGTGTTCAATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-1472s1c1
Sequence:CCGGCCTCTGGCTAAAGGGTGTTATCTCGAGATAACACCCTTTAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-1401s1c1
Sequence:CCGGCTCTTCGTCAAGGCTGGTTATCTCGAGATAACCAGCCTTGACGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-959s1c1
Sequence:CCGGTGAGATTGTAACCACAGAGATCTCGAGATCTCTGTGGTTACAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-1943s1c1
Sequence:CCGGCGCCAAGAAATATAGAGATTTCTCGAGAAATCTCTATATTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172469
CLIC6 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-2052s1c1
Sequence:CCGGCGGGAGATTGAACACGCATATCTCGAGATATGCGTGTTCAATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-1472s1c1
Sequence:CCGGCCTCTGGCTAAAGGGTGTTATCTCGAGATAACACCCTTTAGCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-1401s1c1
Sequence:CCGGCTCTTCGTCAAGGCTGGTTATCTCGAGATAACCAGCCTTGACGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-959s1c1
Sequence:CCGGTGAGATTGTAACCACAGAGATCTCGAGATCTCTGTGGTTACAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172469.1-1943s1c1
Sequence:CCGGCGCCAAGAAATATAGAGATTTCTCGAGAAATCTCTATATTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053277
CLIC6 MISSION shRNA Bacterial Glycerol Stock
chloride intracellular channel 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1376s1c1
Sequence:CCGGCTGGTTATGATGGTGAGAGTACTCGAGTACTCTCACCATCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1515s1c1
Sequence:CCGGCGGAACAAACCCTCCTTTCATCTCGAGATGAAAGGAGGGTTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1638s1c1
Sequence:CCGGCGAATCTAATTCCGCAGGAAACTCGAGTTTCCTGCGGAATTAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1978s1c1
Sequence:CCGGGCTAGAGATGAGTTCACAAATCTCGAGATTTGTGAACTCATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1779s1c1
Sequence:CCGGGCCTGATGAAATAGATGCCTACTCGAGTAGGCATCTATTTCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053277.1-1670s21c1
Sequence:CCGGCCAAATTCTCAGCGTTTATAACTCGAGTTATAAACGCTGAGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053277.1-2014s21c1
Sequence:CCGGCAAGAGATTGAACACGCATATCTCGAGATATGCGTGTTCAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053277.1-2301s21c1
Sequence:CCGGGCAATATCAGAGGGTGTAAAGCTCGAGCTTTACACCCTCTGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053277
CLIC6 MISSION shRNA shRNA Plasmid DNA
chloride intracellular channel 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1376s1c1
Sequence:CCGGCTGGTTATGATGGTGAGAGTACTCGAGTACTCTCACCATCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1515s1c1
Sequence:CCGGCGGAACAAACCCTCCTTTCATCTCGAGATGAAAGGAGGGTTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1638s1c1
Sequence:CCGGCGAATCTAATTCCGCAGGAAACTCGAGTTTCCTGCGGAATTAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1978s1c1
Sequence:CCGGGCTAGAGATGAGTTCACAAATCTCGAGATTTGTGAACTCATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1779s1c1
Sequence:CCGGGCCTGATGAAATAGATGCCTACTCGAGTAGGCATCTATTTCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053277.1-1670s21c1
Sequence:CCGGCCAAATTCTCAGCGTTTATAACTCGAGTTATAAACGCTGAGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053277.1-2014s21c1
Sequence:CCGGCAAGAGATTGAACACGCATATCTCGAGATATGCGTGTTCAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053277.1-2301s21c1
Sequence:CCGGGCAATATCAGAGGGTGTAAAGCTCGAGCTTTACACCCTCTGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053277
CLIC6 MISSION shRNA Lentiviral Transduction Particles
chloride intracellular channel 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1376s1c1
Sequence:CCGGCTGGTTATGATGGTGAGAGTACTCGAGTACTCTCACCATCATAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1515s1c1
Sequence:CCGGCGGAACAAACCCTCCTTTCATCTCGAGATGAAAGGAGGGTTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1638s1c1
Sequence:CCGGCGAATCTAATTCCGCAGGAAACTCGAGTTTCCTGCGGAATTAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1978s1c1
Sequence:CCGGGCTAGAGATGAGTTCACAAATCTCGAGATTTGTGAACTCATCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053277.1-1779s1c1
Sequence:CCGGGCCTGATGAAATAGATGCCTACTCGAGTAGGCATCTATTTCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053277.1-1670s21c1
Sequence:CCGGCCAAATTCTCAGCGTTTATAACTCGAGTTATAAACGCTGAGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053277.1-2014s21c1
Sequence:CCGGCAAGAGATTGAACACGCATATCTCGAGATATGCGTGTTCAATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053277.1-2301s21c1
Sequence:CCGGGCAATATCAGAGGGTGTAAAGCTCGAGCTTTACACCCTCTGATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks