EMAIL THIS PAGE TO A FRIEND

CLINT1

clathrin interactor 1

221 Gene Product Result for
Synonyms: CLINT ENTH EPN4 EPNR
UniProtKB ID: Q14677, B7Z6F8, D3DQJ6, Q8NAF1, Q96E05
Gene ID:
Human(9685) Summary: This gene encodes a protein with similarity to the epsin family of endocytic adapter proteins. The encoded protein interacts with clathrin, the adapter protein AP-1 and phosphoinositides. This protein may be involved in the formation of clathrin coated vesicles and trafficking between the trans-Golgi network and endosomes. Mutations in this gene are associated with a susceptibility to schizophrenia and psychotic disorders. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
Mouse(216705) clathrin interactor 1
Rat(360515) clathrin interactor 1
domestic guinea pig(100732032) clathrin interactor 1
naked mole-rat(101704961) clathrin interactor 1
sheep(101113932) clathrin interactor 1
Domestic Rabbit(100350891) clathrin interactor 1
chicken(416240) clathrin interactor 1
dog(479313) clathrin interactor 1
cow(538540) clathrin interactor 1
domestic cat(101080867) clathrin interactor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014666 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001045520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014666 Rosetta Predictions human pricing
NM_001002022 Rosetta Predictions rat pricing
XM_001068192 Rosetta Predictions rat pricing
XM_001068243 Rosetta Predictions rat pricing
XM_001068335 Rosetta Predictions rat pricing
XM_001068394 Rosetta Predictions rat pricing
XM_001068435 Rosetta Predictions rat pricing
XM_001068485 Rosetta Predictions rat pricing
XM_001068532 Rosetta Predictions rat pricing
NM_001045520 Rosetta Predictions mouse pricing
XM_908092 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019222 predicted 914
2 SASI_Hs01_00019224 predicted 1499
3 SASI_Hs01_00019225 predicted 1280
4 SASI_Hs02_00346009 predicted 538
5 SASI_Hs01_00019226 predicted 1835
6 SASI_Hs01_00019227 predicted 2131
7 SASI_Hs01_00019228 predicted 1627
8 SASI_Hs01_00019229 predicted 453
9 SASI_Hs01_00019230 predicted 1762
10 SASI_Hs01_00019231 predicted 2024
11 SASI_Hs01_00019223 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120515 predicted 1399
2 SASI_Rn01_00120516 predicted 617
3 SASI_Rn01_00120517 predicted 703
4 SASI_Rn01_00120518 predicted 1490
5 SASI_Rn02_00197957 predicted 1476
6 SASI_Rn01_00120520 predicted 1346
7 SASI_Rn01_00120521 predicted 1447
8 SASI_Rn01_00120523 predicted 1399
9 SASI_Rn01_00120524 predicted 397
10 SASI_Rn02_00197958 predicted 310
11 SASI_Rn01_00120519 predicted 469
12 SASI_Rn01_00120522 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323775 predicted 1292
2 SASI_Rn02_00323776 predicted 961
3 SASI_Rn02_00323777 predicted 1237
4 SASI_Rn02_00323778 predicted 1817
5 SASI_Rn02_00323779 predicted 1330
6 SASI_Rn02_00323780 predicted 1013
7 SASI_Rn02_00323781 predicted 1148
8 SASI_Rn02_00323782 predicted 1267
9 SASI_Rn02_00323783 predicted 1400
10 SASI_Rn02_00323784 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323937 predicted 2030
2 SASI_Rn02_00323938 predicted 2354
3 SASI_Rn02_00323939 predicted 2203
4 SASI_Rn02_00323940 predicted 1243
5 SASI_Rn02_00323941 predicted 2290
6 SASI_Rn02_00323942 predicted 2426
7 SASI_Rn02_00323943 predicted 2248
8 SASI_Rn02_00323944 predicted 2542
9 SASI_Rn02_00323945 predicted 2301
10 SASI_Rn02_00323946 predicted 2371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324217 predicted 2022
2 SASI_Rn02_00324218 predicted 2201
3 SASI_Rn02_00324219 predicted 1235
4 SASI_Rn02_00324220 predicted 2292
5 SASI_Rn02_00324221 predicted 1328
6 SASI_Rn02_00324222 predicted 2438
7 SASI_Rn02_00324223 predicted 2209
8 SASI_Rn02_00324224 predicted 2376
9 SASI_Rn02_00324225 predicted 1975
10 SASI_Rn02_00324226 predicted 2431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324383 predicted 1955
2 SASI_Rn02_00324384 predicted 2280
3 SASI_Rn02_00324385 predicted 2075
4 SASI_Rn02_00324386 predicted 1236
5 SASI_Rn02_00324387 predicted 2140
6 SASI_Rn02_00324388 predicted 2218
7 SASI_Rn02_00324389 predicted 2179
8 SASI_Rn02_00324390 predicted 2478
9 SASI_Rn02_00324391 predicted 2231
10 SASI_Rn02_00324392 predicted 2300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068435 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324507 predicted 2033
2 SASI_Rn02_00324508 predicted 2363
3 SASI_Rn02_00324509 predicted 2153
4 SASI_Rn02_00324510 predicted 1236
5 SASI_Rn02_00324511 predicted 2223
6 SASI_Rn02_00324512 predicted 2297
7 SASI_Rn02_00324513 predicted 2261
8 SASI_Rn02_00324514 predicted 2552
9 SASI_Rn02_00324515 predicted 2315
10 SASI_Rn02_00324516 predicted 2375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324655 predicted 2030
2 SASI_Rn02_00324656 predicted 2415
3 SASI_Rn02_00324657 predicted 2207
4 SASI_Rn02_00324658 predicted 1244
5 SASI_Rn02_00324659 predicted 2265
6 SASI_Rn02_00324660 predicted 2345
7 SASI_Rn02_00324661 predicted 2485
8 SASI_Rn02_00324662 predicted 2308
9 SASI_Rn02_00324663 predicted 2607
10 SASI_Rn02_00324664 predicted 2361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324845 predicted 2023
2 SASI_Rn02_00324846 predicted 2354
3 SASI_Rn02_00324847 predicted 2149
4 SASI_Rn02_00324848 predicted 1243
5 SASI_Rn02_00324849 predicted 2212
6 SASI_Rn02_00324850 predicted 2292
7 SASI_Rn02_00324851 predicted 2259
8 SASI_Rn02_00324852 predicted 2551
9 SASI_Rn02_00324853 predicted 2310
10 SASI_Rn02_00324854 predicted 2370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291554 predicted 1830
2 SASI_Mm02_00291555 predicted 550
3 SASI_Mm02_00291556 predicted 1622
4 SASI_Mm02_00291557 predicted 2080
5 SASI_Mm02_00291558 predicted 1725
6 SASI_Mm02_00291559 predicted 1758
7 SASI_Mm02_00291560 predicted 1623
8 SASI_Mm02_00291561 predicted 2085
9 SASI_Mm02_00291562 predicted 575
10 SASI_Mm02_00291563 predicted 2021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908092 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202768 predicted 1975
2 SASI_Mm01_00202769 predicted 635
3 SASI_Mm01_00202770 predicted 1766
4 SASI_Mm01_00202771 predicted 2226
5 SASI_Mm01_00202772 predicted 1584
6 SASI_Mm01_00202773 predicted 1869
7 SASI_Mm01_00202774 predicted 1907
8 SASI_Mm01_00202775 predicted 1619
9 SASI_Mm01_00202776 predicted 664
10 SASI_Mm01_00202777 predicted 2160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014666
VALIDATED
CLINT1 MISSION shRNA Bacterial Glycerol Stock
clathrin interactor 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-961s21c1
Sequence:GTACCGGGACGACAAAGCATATTCATATCTCGAGATATGAATATGCTTTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-412s21c1
Sequence:GTACCGGGAATTGGAGAAGAGTTTATAACTCGAGTTATAAACTCTTCTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014666.2-1501s21c1
Sequence:CCGGCCAGAGTATGAATTTCTCTATCTCGAGATAGAGAAATTCATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-1690s21c1
Sequence:CCGGGCCATCACTGAATACAATGATCTCGAGATCATTGTATTCAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014666.2-1019s21c1
Sequence:CCGGCGCACAGCAAATCCTTCCAAACTCGAGTTTGGAAGGATTTGCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014666.2-332s21c1
Sequence:CCGGGCCAAGGCTACATTTATGTATCTCGAGATACATAAATGTAGCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-2334s21c1
Sequence:GTACCGGATCAACTGAAGAGTCCATTTACTCGAGTAAATGGACTCTTCAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-2493s21c1
Sequence:CCGGACCACTCTTGAGTCCATATATCTCGAGATATATGGACTCAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014666.2-230s1c1
Sequence:CCGGGCCACCAATGTTGTTATGAATCTCGAGATTCATAACAACATTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-1690s1c1
Sequence:CCGGGCCATCACTGAATACAATGATCTCGAGATCATTGTATTCAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-1019s1c1
Sequence:CCGGCGCACAGCAAATCCTTCCAAACTCGAGTTTGGAAGGATTTGCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-1501s1c1
Sequence:CCGGCCAGAGTATGAATTTCTCTATCTCGAGATAGAGAAATTCATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-332s1c1
Sequence:CCGGGCCAAGGCTACATTTATGTATCTCGAGATACATAAATGTAGCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014666
VALIDATED
CLINT1 MISSION shRNA shRNA Plasmid DNA
clathrin interactor 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-961s21c1
Sequence:GTACCGGGACGACAAAGCATATTCATATCTCGAGATATGAATATGCTTTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-412s21c1
Sequence:GTACCGGGAATTGGAGAAGAGTTTATAACTCGAGTTATAAACTCTTCTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014666.2-1501s21c1
Sequence:CCGGCCAGAGTATGAATTTCTCTATCTCGAGATAGAGAAATTCATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-1690s21c1
Sequence:CCGGGCCATCACTGAATACAATGATCTCGAGATCATTGTATTCAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014666.2-1019s21c1
Sequence:CCGGCGCACAGCAAATCCTTCCAAACTCGAGTTTGGAAGGATTTGCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014666.2-332s21c1
Sequence:CCGGGCCAAGGCTACATTTATGTATCTCGAGATACATAAATGTAGCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-2334s21c1
Sequence:GTACCGGATCAACTGAAGAGTCCATTTACTCGAGTAAATGGACTCTTCAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-2493s21c1
Sequence:CCGGACCACTCTTGAGTCCATATATCTCGAGATATATGGACTCAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014666.2-230s1c1
Sequence:CCGGGCCACCAATGTTGTTATGAATCTCGAGATTCATAACAACATTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-1690s1c1
Sequence:CCGGGCCATCACTGAATACAATGATCTCGAGATCATTGTATTCAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-1019s1c1
Sequence:CCGGCGCACAGCAAATCCTTCCAAACTCGAGTTTGGAAGGATTTGCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-1501s1c1
Sequence:CCGGCCAGAGTATGAATTTCTCTATCTCGAGATAGAGAAATTCATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-332s1c1
Sequence:CCGGGCCAAGGCTACATTTATGTATCTCGAGATACATAAATGTAGCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014666
VALIDATED
CLINT1 MISSION shRNA Lentiviral Transduction Particles
clathrin interactor 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-961s21c1
Sequence:GTACCGGGACGACAAAGCATATTCATATCTCGAGATATGAATATGCTTTGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-412s21c1
Sequence:GTACCGGGAATTGGAGAAGAGTTTATAACTCGAGTTATAAACTCTTCTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014666.2-1501s21c1
Sequence:CCGGCCAGAGTATGAATTTCTCTATCTCGAGATAGAGAAATTCATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-1690s21c1
Sequence:CCGGGCCATCACTGAATACAATGATCTCGAGATCATTGTATTCAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014666.2-1019s21c1
Sequence:CCGGCGCACAGCAAATCCTTCCAAACTCGAGTTTGGAAGGATTTGCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014666.2-332s21c1
Sequence:CCGGGCCAAGGCTACATTTATGTATCTCGAGATACATAAATGTAGCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-2334s21c1
Sequence:GTACCGGATCAACTGAAGAGTCCATTTACTCGAGTAAATGGACTCTTCAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014666.2-2493s21c1
Sequence:CCGGACCACTCTTGAGTCCATATATCTCGAGATATATGGACTCAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014666.2-230s1c1
Sequence:CCGGGCCACCAATGTTGTTATGAATCTCGAGATTCATAACAACATTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-1690s1c1
Sequence:CCGGGCCATCACTGAATACAATGATCTCGAGATCATTGTATTCAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-1019s1c1
Sequence:CCGGCGCACAGCAAATCCTTCCAAACTCGAGTTTGGAAGGATTTGCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-1501s1c1
Sequence:CCGGCCAGAGTATGAATTTCTCTATCTCGAGATAGAGAAATTCATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014666.2-332s1c1
Sequence:CCGGGCCAAGGCTACATTTATGTATCTCGAGATACATAAATGTAGCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045520
VALIDATED
CLINT1 MISSION shRNA Bacterial Glycerol Stock
clathrin interactor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-954s21c1
Sequence:CCGGACGGTGACGACGAAGCATATCCTCGAGGATATGCTTCGTCGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-1675s21c1
Sequence:CCGGCCCAGCAGCCATCGCTTAATACTCGAGTATTAAGCGATGGCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-1832s21c1
Sequence:CCGGTATGAACATGCCCGGTGTAATCTCGAGATTACACCGGGCATGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-3066s21c1
Sequence:CCGGCCAATAGAAGTTCGATATATACTCGAGTATATATCGAACTTCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-549s21c1
Sequence:CCGGGGCAAGGATCAAGGTATAAACCTCGAGGTTTATACCTTGATCCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045520
VALIDATED
CLINT1 MISSION shRNA shRNA Plasmid DNA
clathrin interactor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-954s21c1
Sequence:CCGGACGGTGACGACGAAGCATATCCTCGAGGATATGCTTCGTCGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-1675s21c1
Sequence:CCGGCCCAGCAGCCATCGCTTAATACTCGAGTATTAAGCGATGGCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-1832s21c1
Sequence:CCGGTATGAACATGCCCGGTGTAATCTCGAGATTACACCGGGCATGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-3066s21c1
Sequence:CCGGCCAATAGAAGTTCGATATATACTCGAGTATATATCGAACTTCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-549s21c1
Sequence:CCGGGGCAAGGATCAAGGTATAAACCTCGAGGTTTATACCTTGATCCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045520
VALIDATED
CLINT1 MISSION shRNA Lentiviral Transduction Particles
clathrin interactor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-954s21c1
Sequence:CCGGACGGTGACGACGAAGCATATCCTCGAGGATATGCTTCGTCGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-1675s21c1
Sequence:CCGGCCCAGCAGCCATCGCTTAATACTCGAGTATTAAGCGATGGCTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-1832s21c1
Sequence:CCGGTATGAACATGCCCGGTGTAATCTCGAGATTACACCGGGCATGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-3066s21c1
Sequence:CCGGCCAATAGAAGTTCGATATATACTCGAGTATATATCGAACTTCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001045520.3-549s21c1
Sequence:CCGGGGCAAGGATCAAGGTATAAACCTCGAGGTTTATACCTTGATCCTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks