EMAIL THIS PAGE TO A FRIEND

CLIP1

CAP-GLY domain containing linker protein 1

172 Gene Product Result for
Synonyms: CLIP CLIP-170 CLIP170 CYLN1 RSN
UniProtKB ID: P30622, A0AVD3, Q17RS4, Q29RG0
Gene ID:
Human(6249) Summary: The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(56430) CAP-GLY domain containing linker protein 1
Rat(65201) CAP-GLY domain containing linker protein 1
Zebrafish(100537790) CAP-GLY domain containing linker protein 1
chicken(395784) CAP-GLY domain containing linker protein 1
domestic cat(101091733) CAP-GLY domain containing linker protein 1
cow(534624) CAP-GLY domain containing linker protein 1
Horse(100058794) CAP-GLY domain containing linker protein 1
dog(477461) CAP-GLY domain containing linker protein 1
sheep(101121120) CAP-GLY domain containing linker protein 1
Domestic Rabbit(100343861) CAP-GLY domain containing linker protein 1
naked mole-rat(101710895) CAP-GLY domain containing linker protein 1
domestic guinea pig(100723601) CAP-GLY domain containing linker protein 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002956 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002956 Rosetta Predictions human pricing
NM_198240 Rosetta Predictions human pricing
NM_031745 Rosetta Predictions rat pricing
NM_019765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143390 predicted 4417
2 SASI_Hs02_00334802 predicted 3924
3 SASI_Hs01_00143391 predicted 2600
4 SASI_Hs02_00334803 predicted 3335
5 SASI_Hs01_00143392 predicted 2202
6 SASI_Hs01_00143393 predicted 2523
7 SASI_Hs01_00143395 predicted 2119
8 SASI_Hs02_00334804 predicted 230
9 SASI_Hs01_00143396 predicted 3639
10 SASI_Hs01_00143397 predicted 3725
11 SASI_Hs01_00143394 predicted 3240
12 SASI_Hs01_00143398 predicted 806
13 SASI_Hs01_00143399 predicted 3164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222721 predicted 4310
2 SASI_Hs02_00371774 predicted 3817
3 SASI_Hs01_00222722 predicted 2495
4 SASI_Hs02_00371775 predicted 3235
5 SASI_Hs01_00222723 predicted 2100
6 SASI_Hs01_00222724 predicted 2420
7 SASI_Hs01_00222726 predicted 2010
8 SASI_Hs02_00371776 predicted 231
9 SASI_Hs01_00222727 predicted 3529
10 SASI_Hs01_00222728 predicted 3618
11 SASI_Hs01_00222725 predicted 3133
12 SASI_Hs01_00222729 predicted 809
13 SASI_Hs01_00222730 predicted 3059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052420 predicted 3652
2 SASI_Rn01_00052421 predicted 3156
3 SASI_Rn01_00052423 predicted 2100
4 SASI_Rn01_00052424 predicted 2137
5 SASI_Rn01_00052425 predicted 1675
6 SASI_Rn02_00265153 predicted 3389
7 SASI_Rn01_00052426 predicted 2081
8 SASI_Rn01_00052427 predicted 3395
9 SASI_Rn02_00265154 predicted 1758
10 SASI_Rn01_00052428 predicted 2576
11 SASI_Rn01_00052419 predicted 2463
12 SASI_Rn01_00052422 predicted 2851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046068 predicted 347
2 SASI_Mm01_00046069 predicted 1475
3 SASI_Mm01_00046071 predicted 1832
4 SASI_Mm01_00046072 predicted 2000
5 SASI_Mm01_00046073 predicted 1536
6 SASI_Mm01_00046074 predicted 2447
7 SASI_Mm01_00046075 predicted 3922
8 SASI_Mm02_00324953 predicted 3311
9 SASI_Mm01_00046076 predicted 3602
10 SASI_Mm02_00324954 predicted 2513
11 SASI_Mm01_00046067 predicted 1982
12 SASI_Mm01_00046070 predicted 2672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002956
VALIDATED
CLIP1 MISSION shRNA Bacterial Glycerol Stock
CAP-GLY domain containing linker protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002956.2-4548s1c1
Sequence:CCGGCCCGTCAACAAATCTAGGAAACTCGAGTTTCCTAGATTTGTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002956.2-1859s1c1
Sequence:CCGGCCGGGAAGAAACTCATCAGAACTCGAGTTCTGATGAGTTTCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002956.2-645s1c1
Sequence:CCGGCCTTCAAACATCCCTCAGAAACTCGAGTTTCTGAGGGATGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002956.2-1485s1c1
Sequence:CCGGCGGGTTGAAGAAGAATCAATTCTCGAGAATTGATTCTTCTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002956.2-2474s1c1
Sequence:CCGGCGAAGGTAAATCGGAAATGAACTCGAGTTCATTTCCGATTTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002956.2-2124s21c1
Sequence:CCGGCTAGATTACCAACACGAAATACTCGAGTATTTCGTGTTGGTAATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002956.2-489s21c1
Sequence:CCGGGAACCTTTAAAGGGCATATTTCTCGAGAAATATGCCCTTTAAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002956.2-1535s21c1
Sequence:CCGGACTGGAGCATGCCCGCATTAACTCGAGTTAATGCGGGCATGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002956.2-4740s21c1
Sequence:CCGGTACCCTCACAATACCTTATTTCTCGAGAAATAAGGTATTGTGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002956.2-1485s21c1
Sequence:CCGGCGGGTTGAAGAAGAATCAATTCTCGAGAATTGATTCTTCTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002956
VALIDATED
CLIP1 MISSION shRNA shRNA Plasmid DNA
CAP-GLY domain containing linker protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002956.2-4548s1c1
Sequence:CCGGCCCGTCAACAAATCTAGGAAACTCGAGTTTCCTAGATTTGTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002956.2-1859s1c1
Sequence:CCGGCCGGGAAGAAACTCATCAGAACTCGAGTTCTGATGAGTTTCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002956.2-645s1c1
Sequence:CCGGCCTTCAAACATCCCTCAGAAACTCGAGTTTCTGAGGGATGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002956.2-1485s1c1
Sequence:CCGGCGGGTTGAAGAAGAATCAATTCTCGAGAATTGATTCTTCTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002956.2-2474s1c1
Sequence:CCGGCGAAGGTAAATCGGAAATGAACTCGAGTTCATTTCCGATTTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002956.2-2124s21c1
Sequence:CCGGCTAGATTACCAACACGAAATACTCGAGTATTTCGTGTTGGTAATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002956.2-489s21c1
Sequence:CCGGGAACCTTTAAAGGGCATATTTCTCGAGAAATATGCCCTTTAAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002956.2-1535s21c1
Sequence:CCGGACTGGAGCATGCCCGCATTAACTCGAGTTAATGCGGGCATGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002956.2-4740s21c1
Sequence:CCGGTACCCTCACAATACCTTATTTCTCGAGAAATAAGGTATTGTGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002956.2-1485s21c1
Sequence:CCGGCGGGTTGAAGAAGAATCAATTCTCGAGAATTGATTCTTCTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002956
VALIDATED
CLIP1 MISSION shRNA Lentiviral Transduction Particles
CAP-GLY domain containing linker protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_002956.2-4548s1c1
Sequence:CCGGCCCGTCAACAAATCTAGGAAACTCGAGTTTCCTAGATTTGTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002956.2-1859s1c1
Sequence:CCGGCCGGGAAGAAACTCATCAGAACTCGAGTTCTGATGAGTTTCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002956.2-645s1c1
Sequence:CCGGCCTTCAAACATCCCTCAGAAACTCGAGTTTCTGAGGGATGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002956.2-1485s1c1
Sequence:CCGGCGGGTTGAAGAAGAATCAATTCTCGAGAATTGATTCTTCTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002956.2-2474s1c1
Sequence:CCGGCGAAGGTAAATCGGAAATGAACTCGAGTTCATTTCCGATTTACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002956.2-2124s21c1
Sequence:CCGGCTAGATTACCAACACGAAATACTCGAGTATTTCGTGTTGGTAATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002956.2-489s21c1
Sequence:CCGGGAACCTTTAAAGGGCATATTTCTCGAGAAATATGCCCTTTAAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002956.2-1535s21c1
Sequence:CCGGACTGGAGCATGCCCGCATTAACTCGAGTTAATGCGGGCATGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002956.2-4740s21c1
Sequence:CCGGTACCCTCACAATACCTTATTTCTCGAGAAATAAGGTATTGTGAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_002956.2-1485s21c1
Sequence:CCGGCGGGTTGAAGAAGAATCAATTCTCGAGAATTGATTCTTCTTCAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019765
VALIDATED
CLIP1 MISSION shRNA Bacterial Glycerol Stock
CAP-GLY domain containing linker protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019765.2-4393s1c1
Sequence:CCGGGCCAGCATTGGTGTGCAACTTCTCGAGAAGTTGCACACCAATGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019765.2-2647s1c1
Sequence:CCGGCCGTAAATAAACTGCACCAAACTCGAGTTTGGTGCAGTTTATTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019765.2-369s1c1
Sequence:CCGGCCCGGATTTATCCAGTTTCTTCTCGAGAAGAAACTGGATAAATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019765.2-1546s1c1
Sequence:CCGGCCCGAATAATGGAACTAGAAACTCGAGTTTCTAGTTCCATTATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019765.2-1976s1c1
Sequence:CCGGCGCTGAATTTGCTGAGTTAAACTCGAGTTTAACTCAGCAAATTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019765.4-3610s21c1
Sequence:CCGGAGAACGATCTGTACTCAATAACTCGAGTTATTGAGTACAGATCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019765.4-1828s21c1
Sequence:CCGGCAAGCTCGACCACGCTAATAACTCGAGTTATTAGCGTGGTCGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019765.4-2009s21c1
Sequence:CCGGCTAGATTACCAGCACGAAATACTCGAGTATTTCGTGCTGGTAATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019765
VALIDATED
CLIP1 MISSION shRNA shRNA Plasmid DNA
CAP-GLY domain containing linker protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019765.2-4393s1c1
Sequence:CCGGGCCAGCATTGGTGTGCAACTTCTCGAGAAGTTGCACACCAATGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019765.2-2647s1c1
Sequence:CCGGCCGTAAATAAACTGCACCAAACTCGAGTTTGGTGCAGTTTATTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019765.2-369s1c1
Sequence:CCGGCCCGGATTTATCCAGTTTCTTCTCGAGAAGAAACTGGATAAATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019765.2-1546s1c1
Sequence:CCGGCCCGAATAATGGAACTAGAAACTCGAGTTTCTAGTTCCATTATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019765.2-1976s1c1
Sequence:CCGGCGCTGAATTTGCTGAGTTAAACTCGAGTTTAACTCAGCAAATTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019765.4-3610s21c1
Sequence:CCGGAGAACGATCTGTACTCAATAACTCGAGTTATTGAGTACAGATCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019765.4-1828s21c1
Sequence:CCGGCAAGCTCGACCACGCTAATAACTCGAGTTATTAGCGTGGTCGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019765.4-2009s21c1
Sequence:CCGGCTAGATTACCAGCACGAAATACTCGAGTATTTCGTGCTGGTAATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019765
VALIDATED
CLIP1 MISSION shRNA Lentiviral Transduction Particles
CAP-GLY domain containing linker protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019765.2-4393s1c1
Sequence:CCGGGCCAGCATTGGTGTGCAACTTCTCGAGAAGTTGCACACCAATGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019765.2-2647s1c1
Sequence:CCGGCCGTAAATAAACTGCACCAAACTCGAGTTTGGTGCAGTTTATTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019765.2-369s1c1
Sequence:CCGGCCCGGATTTATCCAGTTTCTTCTCGAGAAGAAACTGGATAAATCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019765.2-1546s1c1
Sequence:CCGGCCCGAATAATGGAACTAGAAACTCGAGTTTCTAGTTCCATTATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019765.2-1976s1c1
Sequence:CCGGCGCTGAATTTGCTGAGTTAAACTCGAGTTTAACTCAGCAAATTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019765.4-3610s21c1
Sequence:CCGGAGAACGATCTGTACTCAATAACTCGAGTTATTGAGTACAGATCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019765.4-1828s21c1
Sequence:CCGGCAAGCTCGACCACGCTAATAACTCGAGTTATTAGCGTGGTCGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019765.4-2009s21c1
Sequence:CCGGCTAGATTACCAGCACGAAATACTCGAGTATTTCGTGCTGGTAATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks