EMAIL THIS PAGE TO A FRIEND

CLIP2

CAP-GLY domain containing linker protein 2

96 Gene Product Result for
Synonyms: CLIP CLIP-115 CYLN2 WBSCR3 WBSCR4 WSCR3 WSCR4
UniProtKB ID: Q9UDT6, O14527, O43611
Gene ID:
Human(7461) Summary: The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Mouse(269713) CAP-GLY domain containing linker protein 2
Rat(29264) CAP-GLY domain containing linker protein 2
Zebrafish(556406) CAP-GLY domain containing linker protein 2
chicken(417488) CAP-GLY domain containing linker protein 2
cow(506908) CAP-GLY domain containing linker protein 2
Horse(100062200) CAP-GLY domain containing linker protein 2
domestic cat(101098596) CAP-GLY domain containing linker protein 2
dog(489797) CAP-GLY domain containing linker protein 2
domestic guinea pig(100725842) CAP-GLY domain containing linker protein 2
naked mole-rat(101725100) CAP-GLY domain containing linker protein 2
sheep(101110113) CAP-GLY domain containing linker protein 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003388 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003388 Rosetta Predictions human pricing
NM_032421 Rosetta Predictions human pricing
NM_021997 Rosetta Predictions rat pricing
NM_001039162 Rosetta Predictions mouse pricing
NM_009990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335558 predicted 3576
2 SASI_Hs02_00335559 predicted 1045
3 SASI_Hs02_00335560 predicted 3593
4 SASI_Hs02_00335561 predicted 899
5 SASI_Hs02_00335562 predicted 3399
6 SASI_Hs01_00210151 predicted 3730
7 SASI_Hs02_00335563 predicted 3142
8 SASI_Hs02_00335564 predicted 2271
9 SASI_Hs02_00335565 predicted 2567
10 SASI_Hs02_00335566 predicted 3374
11 SASI_Hs01_00210149 predicted 1183
12 SASI_Hs01_00210150 predicted 2563
13 SASI_Hs01_00210152 predicted 2860
14 SASI_Hs01_00210153 predicted 2746
15 SASI_Hs01_00210154 predicted 1347
16 SASI_Hs01_00210155 predicted 2663
17 SASI_Hs01_00210156 predicted 2754
18 SASI_Hs01_00210157 predicted 2276
19 SASI_Hs01_00210158 predicted 3814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359817 predicted 3463
2 SASI_Hs02_00359818 predicted 1046
3 SASI_Hs02_00359819 predicted 3489
4 SASI_Hs02_00359820 predicted 896
5 SASI_Hs02_00359821 predicted 3292
6 SASI_Hs01_00157653 predicted 3630
7 SASI_Hs02_00359822 predicted 3033
8 SASI_Hs02_00359823 predicted 2167
9 SASI_Hs02_00359824 predicted 2464
10 SASI_Hs02_00359825 predicted 3269
11 SASI_Hs01_00157651 predicted 1183
12 SASI_Hs01_00157652 predicted 2458
13 SASI_Hs01_00157654 predicted 2758
14 SASI_Hs01_00157655 predicted 2643
15 SASI_Hs01_00157656 predicted 1346
16 SASI_Hs01_00157657 predicted 2561
17 SASI_Hs01_00157658 predicted 2641
18 SASI_Hs01_00157659 predicted 2177
19 SASI_Hs01_00157660 predicted 3710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067581 predicted 1118
2 SASI_Rn01_00067582 predicted 1177
3 SASI_Rn01_00067583 predicted 3510
4 SASI_Rn01_00067585 predicted 1983
5 SASI_Rn01_00067586 predicted 3395
6 SASI_Rn01_00067587 predicted 516
7 SASI_Rn01_00067588 predicted 2711
8 SASI_Rn01_00067589 predicted 2539
9 SASI_Rn02_00262904 predicted 362
10 SASI_Rn01_00067590 predicted 3184
11 SASI_Rn01_00067584 predicted 3522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088406 predicted 1285
2 SASI_Mm01_00088407 predicted 1346
3 SASI_Mm01_00088408 predicted 685
4 SASI_Mm01_00088409 predicted 3470
5 SASI_Mm01_00088412 predicted 1410
6 SASI_Mm01_00088413 predicted 1019
7 SASI_Mm01_00088414 predicted 924
8 SASI_Mm01_00088415 predicted 1287
9 SASI_Mm02_00289916 predicted 2788
10 SASI_Mm02_00289917 predicted 2898
11 SASI_Mm01_00088410 predicted 1316
12 SASI_Mm01_00088411 predicted 2615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021459 predicted 1281
2 SASI_Mm01_00021460 predicted 1351
3 SASI_Mm01_00021461 predicted 680
4 SASI_Mm01_00021462 predicted 3571
5 SASI_Mm01_00021465 predicted 1415
6 SASI_Mm01_00021466 predicted 1022
7 SASI_Mm01_00021467 predicted 921
8 SASI_Mm01_00021468 predicted 1282
9 SASI_Mm02_00317595 predicted 2889
10 SASI_Mm02_00317596 predicted 3009
11 SASI_Mm01_00021463 predicted 1323
12 SASI_Mm01_00021464 predicted 2724
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003388
CLIP2 MISSION shRNA Bacterial Glycerol Stock
CAP-GLY domain containing linker protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-3394s21c1
Sequence:CCGGACCATCGGCAATTCCGGTTCTCTCGAGAGAACCGGAATTGCCGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-615s21c1
Sequence:CCGGGTATCTGGGAGAGACGCAGTTCTCGAGAACTGCGTCTCTCCCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-1171s21c1
Sequence:CCGGATCCACAAAGTGATCCGTATCCTCGAGGATACGGATCACTTTGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-1219s21c1
Sequence:CCGGGCCAAGAAGACCAAGCGTATGCTCGAGCATACGCTTGGTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003388.3-2748s1c1
Sequence:CCGGCATGATTGAGTCGAATGACATCTCGAGATGTCATTCGACTCAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003388.3-1528s1c1
Sequence:CCGGGCACAGCATGAGCAGTATGTTCTCGAGAACATACTGCTCATGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003388.3-2013s1c1
Sequence:CCGGGCTGCGGGATAAATACGAGAACTCGAGTTCTCGTATTTATCCCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180187    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003388.3-5218s1c1
Sequence:CCGGCCAGGGTCAAATACAGCTCTTCTCGAGAAGAGCTGTATTTGACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003388
CLIP2 MISSION shRNA shRNA Plasmid DNA
CAP-GLY domain containing linker protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-3394s21c1
Sequence:CCGGACCATCGGCAATTCCGGTTCTCTCGAGAGAACCGGAATTGCCGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-615s21c1
Sequence:CCGGGTATCTGGGAGAGACGCAGTTCTCGAGAACTGCGTCTCTCCCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-1171s21c1
Sequence:CCGGATCCACAAAGTGATCCGTATCCTCGAGGATACGGATCACTTTGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-1219s21c1
Sequence:CCGGGCCAAGAAGACCAAGCGTATGCTCGAGCATACGCTTGGTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003388.3-2748s1c1
Sequence:CCGGCATGATTGAGTCGAATGACATCTCGAGATGTCATTCGACTCAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003388.3-1528s1c1
Sequence:CCGGGCACAGCATGAGCAGTATGTTCTCGAGAACATACTGCTCATGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003388.3-2013s1c1
Sequence:CCGGGCTGCGGGATAAATACGAGAACTCGAGTTCTCGTATTTATCCCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180187    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003388.3-5218s1c1
Sequence:CCGGCCAGGGTCAAATACAGCTCTTCTCGAGAAGAGCTGTATTTGACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003388
CLIP2 MISSION shRNA Lentiviral Transduction Particles
CAP-GLY domain containing linker protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-3394s21c1
Sequence:CCGGACCATCGGCAATTCCGGTTCTCTCGAGAGAACCGGAATTGCCGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-615s21c1
Sequence:CCGGGTATCTGGGAGAGACGCAGTTCTCGAGAACTGCGTCTCTCCCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-1171s21c1
Sequence:CCGGATCCACAAAGTGATCCGTATCCTCGAGGATACGGATCACTTTGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003388.4-1219s21c1
Sequence:CCGGGCCAAGAAGACCAAGCGTATGCTCGAGCATACGCTTGGTCTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003388.3-2748s1c1
Sequence:CCGGCATGATTGAGTCGAATGACATCTCGAGATGTCATTCGACTCAATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003388.3-1528s1c1
Sequence:CCGGGCACAGCATGAGCAGTATGTTCTCGAGAACATACTGCTCATGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003388.3-2013s1c1
Sequence:CCGGGCTGCGGGATAAATACGAGAACTCGAGTTCTCGTATTTATCCCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180187    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003388.3-5218s1c1
Sequence:CCGGCCAGGGTCAAATACAGCTCTTCTCGAGAAGAGCTGTATTTGACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009990
VALIDATED
CLIP2 MISSION shRNA Bacterial Glycerol Stock
CAP-GLY domain containing linker protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009990.2-2140s21c1
Sequence:CCGGACCTTGCTCCAGGACAAATATCTCGAGATATTTGTCCTGGAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009990.2-1304s21c1
Sequence:CCGGTCCACAAGGTCATCCGAATTGCTCGAGCAATTCGGATGACCTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009990.2-3896s21c1
Sequence:CCGGTTGGGCCTCTCTTGACTATAGCTCGAGCTATAGTCAAGAGAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009990.2-1660s21c1
Sequence:CCGGGCACAGCATGAGCAGTATGTTCTCGAGAACATACTGCTCATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009990.2-3264s21c1
Sequence:CCGGCAAAGCTGAATGGCGGATAAACTCGAGTTTATCCGCCATTCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009990.1-1204s1c1
Sequence:CCGGGCACAGCATGAGCAGTATGTTCTCGAGAACATACTGCTCATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009990.1-2805s1c1
Sequence:CCGGCAAAGCTGAATGGCGGATAAACTCGAGTTTATCCGCCATTCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009990.1-2552s1c1
Sequence:CCGGCCCAAGTAAGTGTTCTAGAAACTCGAGTTTCTAGAACACTTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009990.1-2804s1c1
Sequence:CCGGACAAAGCTGAATGGCGGATAACTCGAGTTATCCGCCATTCAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009990
VALIDATED
CLIP2 MISSION shRNA shRNA Plasmid DNA
CAP-GLY domain containing linker protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009990.2-2140s21c1
Sequence:CCGGACCTTGCTCCAGGACAAATATCTCGAGATATTTGTCCTGGAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009990.2-1304s21c1
Sequence:CCGGTCCACAAGGTCATCCGAATTGCTCGAGCAATTCGGATGACCTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009990.2-3896s21c1
Sequence:CCGGTTGGGCCTCTCTTGACTATAGCTCGAGCTATAGTCAAGAGAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009990.2-1660s21c1
Sequence:CCGGGCACAGCATGAGCAGTATGTTCTCGAGAACATACTGCTCATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009990.2-3264s21c1
Sequence:CCGGCAAAGCTGAATGGCGGATAAACTCGAGTTTATCCGCCATTCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009990.1-1204s1c1
Sequence:CCGGGCACAGCATGAGCAGTATGTTCTCGAGAACATACTGCTCATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009990.1-2805s1c1
Sequence:CCGGCAAAGCTGAATGGCGGATAAACTCGAGTTTATCCGCCATTCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009990.1-2552s1c1
Sequence:CCGGCCCAAGTAAGTGTTCTAGAAACTCGAGTTTCTAGAACACTTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009990.1-2804s1c1
Sequence:CCGGACAAAGCTGAATGGCGGATAACTCGAGTTATCCGCCATTCAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009990
VALIDATED
CLIP2 MISSION shRNA Lentiviral Transduction Particles
CAP-GLY domain containing linker protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009990.2-2140s21c1
Sequence:CCGGACCTTGCTCCAGGACAAATATCTCGAGATATTTGTCCTGGAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009990.2-1304s21c1
Sequence:CCGGTCCACAAGGTCATCCGAATTGCTCGAGCAATTCGGATGACCTTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009990.2-3896s21c1
Sequence:CCGGTTGGGCCTCTCTTGACTATAGCTCGAGCTATAGTCAAGAGAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009990.2-1660s21c1
Sequence:CCGGGCACAGCATGAGCAGTATGTTCTCGAGAACATACTGCTCATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009990.2-3264s21c1
Sequence:CCGGCAAAGCTGAATGGCGGATAAACTCGAGTTTATCCGCCATTCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009990.1-1204s1c1
Sequence:CCGGGCACAGCATGAGCAGTATGTTCTCGAGAACATACTGCTCATGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009990.1-2805s1c1
Sequence:CCGGCAAAGCTGAATGGCGGATAAACTCGAGTTTATCCGCCATTCAGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009990.1-2552s1c1
Sequence:CCGGCCCAAGTAAGTGTTCTAGAAACTCGAGTTTCTAGAACACTTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009990.1-2804s1c1
Sequence:CCGGACAAAGCTGAATGGCGGATAACTCGAGTTATCCGCCATTCAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks