EMAIL THIS PAGE TO A FRIEND

CLIP3

CAP-GLY domain containing linker protein 3

134 Gene Product Result for
Synonyms: CLIPR-59 CLIPR59 RSNL1
UniProtKB ID: Q96DZ5, A8K0E4, Q8WWL1, Q96C99, Q9UFT7
Gene ID:
Human(25999) Summary: This gene encodes a member of the cytoplasmic linker protein 170 family. Members of this protein family contain a cytoskeleton-associated protein glycine-rich domain and mediate the interaction of microtubules with cellular organelles. The encoded protein plays a role in T cell apoptosis by facilitating the association of tubulin and the lipid raft ganglioside GD3. The encoded protein also functions as a scaffold protein mediating membrane localization of phosphorylated protein kinase B. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(76686) CAP-GLY domain containing linker protein 3
Rat(308493) CAP-GLY domain containing linker protein 3
sheep(101106102) CAP-GLY domain containing linker protein 3
Domestic Rabbit(100355988) CAP-GLY domain containing linker protein 3
naked mole-rat(101712210) CAP-GLY domain containing linker protein 3
domestic guinea pig(100727204) CAP-GLY domain containing linker protein 3
dog(484566) CAP-GLY domain containing linker protein 3
domestic cat(101080597) CAP-GLY domain containing linker protein 3
cow(522965) CAP-GLY domain containing linker protein 3
Horse(100051864) CAP-GLY domain containing linker protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015526 Rosetta Predictions human pricing
NM_001107501 Rosetta Predictions rat pricing
NM_001081114 Rosetta Predictions mouse pricing
XM_133283 Rosetta Predictions mouse pricing
XM_915194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059516 predicted 2279
2 SASI_Hs01_00059517 predicted 1965
3 SASI_Hs01_00059518 predicted 2232
4 SASI_Hs01_00059521 predicted 1528
5 SASI_Hs01_00059522 predicted 1938
6 SASI_Hs01_00059523 predicted 684
7 SASI_Hs01_00059524 predicted 1649
8 SASI_Hs01_00059525 predicted 1921
9 SASI_Hs02_00348026 predicted 697
10 SASI_Hs02_00348027 predicted 2043
11 SASI_Hs01_00059519 predicted 1582
12 SASI_Hs01_00059520 predicted 2049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229445 predicted 476
2 SASI_Rn02_00229446 predicted 1766
3 SASI_Rn02_00229447 predicted 1565
4 SASI_Rn02_00229448 predicted 1694
5 SASI_Rn02_00229449 predicted 697
6 SASI_Rn02_00229450 predicted 661
7 SASI_Rn02_00229451 predicted 1742
8 SASI_Rn02_00229452 predicted 1637
9 SASI_Rn02_00229453 predicted 1497
10 SASI_Rn02_00229454 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295321 predicted 1520
2 SASI_Mm02_00295322 predicted 1871
3 SASI_Mm02_00295323 predicted 1437
4 SASI_Mm02_00295324 predicted 432
5 SASI_Mm02_00295325 predicted 1455
6 SASI_Mm02_00295326 predicted 1590
7 SASI_Mm02_00295327 predicted 927
8 SASI_Mm02_00295328 predicted 627
9 SASI_Mm02_00295329 predicted 494
10 SASI_Mm02_00295330 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233372 predicted 1526
2 SASI_Mm01_00233373 predicted 1871
3 SASI_Mm01_00233374 predicted 1448
4 SASI_Mm01_00233375 predicted 433
5 SASI_Mm01_00233376 predicted 1467
6 SASI_Mm01_00233377 predicted 1602
7 SASI_Mm01_00233378 predicted 1654
8 SASI_Mm01_00233379 predicted 935
9 SASI_Mm01_00233380 predicted 626
10 SASI_Mm01_00233381 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254883 predicted 1623
2 SASI_Mm01_00254884 predicted 1964
3 SASI_Mm01_00254885 predicted 1540
4 SASI_Mm01_00254886 predicted 530
5 SASI_Mm01_00254887 predicted 1553
6 SASI_Mm01_00254888 predicted 1697
7 SASI_Mm01_00254889 predicted 1745
8 SASI_Mm01_00254890 predicted 1027
9 SASI_Mm01_00254891 predicted 726
10 SASI_Mm01_00254892 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015526
CLIP3 MISSION shRNA Bacterial Glycerol Stock
CAP-GLY domain containing linker protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-1573s1c1
Sequence:CCGGCAAGCATGATGGCTCTGTCTTCTCGAGAAGACAGAGCCATCATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-560s1c1
Sequence:CCGGGACATGACACTGCTCCACTATCTCGAGATAGTGGAGCAGTGTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-1711s1c1
Sequence:CCGGGCATCAAGTGACAATGACGCACTCGAGTGCGTCATTGTCACTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-1036s1c1
Sequence:CCGGGCTACCCAACTATGACAACGTCTCGAGACGTTGTCATAGTTGGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-688s1c1
Sequence:CCGGCAACATGAACGCGCTTCACTACTCGAGTAGTGAAGCGCGTTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-1762s1c1
Sequence:CCGGCCCAAAGGACATTGCATCAGACTCGAGTCTGATGCAATGTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-484s1c1
Sequence:CCGGCCAGCACAAGATAGACGTCATCTCGAGATGACGTCTATCTTGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-1378s1c1
Sequence:CCGGCAGGGAACACAAAGGCAAGAACTCGAGTTCTTGCCTTTGTGTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-379s1c1
Sequence:CCGGCACCTTCTTCGATCCCAATGACTCGAGTCATTGGGATCGAAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015526
CLIP3 MISSION shRNA shRNA Plasmid DNA
CAP-GLY domain containing linker protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-1573s1c1
Sequence:CCGGCAAGCATGATGGCTCTGTCTTCTCGAGAAGACAGAGCCATCATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-560s1c1
Sequence:CCGGGACATGACACTGCTCCACTATCTCGAGATAGTGGAGCAGTGTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-1711s1c1
Sequence:CCGGGCATCAAGTGACAATGACGCACTCGAGTGCGTCATTGTCACTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-1036s1c1
Sequence:CCGGGCTACCCAACTATGACAACGTCTCGAGACGTTGTCATAGTTGGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-688s1c1
Sequence:CCGGCAACATGAACGCGCTTCACTACTCGAGTAGTGAAGCGCGTTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-1762s1c1
Sequence:CCGGCCCAAAGGACATTGCATCAGACTCGAGTCTGATGCAATGTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-484s1c1
Sequence:CCGGCCAGCACAAGATAGACGTCATCTCGAGATGACGTCTATCTTGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-1378s1c1
Sequence:CCGGCAGGGAACACAAAGGCAAGAACTCGAGTTCTTGCCTTTGTGTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-379s1c1
Sequence:CCGGCACCTTCTTCGATCCCAATGACTCGAGTCATTGGGATCGAAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015526
CLIP3 MISSION shRNA Lentiviral Transduction Particles
CAP-GLY domain containing linker protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-1573s1c1
Sequence:CCGGCAAGCATGATGGCTCTGTCTTCTCGAGAAGACAGAGCCATCATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-560s1c1
Sequence:CCGGGACATGACACTGCTCCACTATCTCGAGATAGTGGAGCAGTGTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-1711s1c1
Sequence:CCGGGCATCAAGTGACAATGACGCACTCGAGTGCGTCATTGTCACTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-1036s1c1
Sequence:CCGGGCTACCCAACTATGACAACGTCTCGAGACGTTGTCATAGTTGGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015526.1-688s1c1
Sequence:CCGGCAACATGAACGCGCTTCACTACTCGAGTAGTGAAGCGCGTTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-1762s1c1
Sequence:CCGGCCCAAAGGACATTGCATCAGACTCGAGTCTGATGCAATGTCCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-484s1c1
Sequence:CCGGCCAGCACAAGATAGACGTCATCTCGAGATGACGTCTATCTTGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158097    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-1378s1c1
Sequence:CCGGCAGGGAACACAAAGGCAAGAACTCGAGTTCTTGCCTTTGTGTTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015526.1-379s1c1
Sequence:CCGGCACCTTCTTCGATCCCAATGACTCGAGTCATTGGGATCGAAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081114
CLIP3 MISSION shRNA Bacterial Glycerol Stock
CAP-GLY domain containing linker protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1450s21c1
Sequence:CCGGTCTATGGGAAGACTGACTTTGCTCGAGCAAAGTCAGTCTTCCCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1312s21c1
Sequence:CCGGAGGGCCGAAGAGAACACAAAGCTCGAGCTTTGTGTTCTCTTCGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081114.1-2925s21c1
Sequence:CCGGTTAGTCCATGGATCATCTAATCTCGAGATTAGATGATCCATGGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-439s21c1
Sequence:CCGGATGTCATTGGCAACGAGATTCCTCGAGGAATCTCGTTGCCAATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1531s21c1
Sequence:CCGGTGTTCGGCGTCCGGTACTTTACTCGAGTAAAGTACCGGACGCCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-501s21c1
Sequence:GTACCGGGATATGACACTGCTCCATTATCTCGAGATAATGGAGCAGTGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081114.1-2261s21c1
Sequence:CCGGTCACCAGAAAGCCCTTATATTCTCGAGAATATAAGGGCTTTCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-641s21c1
Sequence:CCGGCCTTCACTATGCCGCCTATTTCTCGAGAAATAGGCGGCATAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1713s21c1
Sequence:CCGGATTGCGTCAGAGAACTCTATCCTCGAGGATAGAGTTCTCTGACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1286s21c1
Sequence:CCGGGATGGACTTCTCCCGTGTAACCTCGAGGTTACACGGGAGAAGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081114
CLIP3 MISSION shRNA shRNA Plasmid DNA
CAP-GLY domain containing linker protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1450s21c1
Sequence:CCGGTCTATGGGAAGACTGACTTTGCTCGAGCAAAGTCAGTCTTCCCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1312s21c1
Sequence:CCGGAGGGCCGAAGAGAACACAAAGCTCGAGCTTTGTGTTCTCTTCGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081114.1-2925s21c1
Sequence:CCGGTTAGTCCATGGATCATCTAATCTCGAGATTAGATGATCCATGGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-439s21c1
Sequence:CCGGATGTCATTGGCAACGAGATTCCTCGAGGAATCTCGTTGCCAATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1531s21c1
Sequence:CCGGTGTTCGGCGTCCGGTACTTTACTCGAGTAAAGTACCGGACGCCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-501s21c1
Sequence:GTACCGGGATATGACACTGCTCCATTATCTCGAGATAATGGAGCAGTGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081114.1-2261s21c1
Sequence:CCGGTCACCAGAAAGCCCTTATATTCTCGAGAATATAAGGGCTTTCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-641s21c1
Sequence:CCGGCCTTCACTATGCCGCCTATTTCTCGAGAAATAGGCGGCATAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1713s21c1
Sequence:CCGGATTGCGTCAGAGAACTCTATCCTCGAGGATAGAGTTCTCTGACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1286s21c1
Sequence:CCGGGATGGACTTCTCCCGTGTAACCTCGAGGTTACACGGGAGAAGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081114
CLIP3 MISSION shRNA Lentiviral Transduction Particles
CAP-GLY domain containing linker protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1450s21c1
Sequence:CCGGTCTATGGGAAGACTGACTTTGCTCGAGCAAAGTCAGTCTTCCCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1312s21c1
Sequence:CCGGAGGGCCGAAGAGAACACAAAGCTCGAGCTTTGTGTTCTCTTCGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081114.1-2925s21c1
Sequence:CCGGTTAGTCCATGGATCATCTAATCTCGAGATTAGATGATCCATGGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-439s21c1
Sequence:CCGGATGTCATTGGCAACGAGATTCCTCGAGGAATCTCGTTGCCAATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1531s21c1
Sequence:CCGGTGTTCGGCGTCCGGTACTTTACTCGAGTAAAGTACCGGACGCCGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-501s21c1
Sequence:GTACCGGGATATGACACTGCTCCATTATCTCGAGATAATGGAGCAGTGTCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081114.1-2261s21c1
Sequence:CCGGTCACCAGAAAGCCCTTATATTCTCGAGAATATAAGGGCTTTCTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-641s21c1
Sequence:CCGGCCTTCACTATGCCGCCTATTTCTCGAGAAATAGGCGGCATAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1713s21c1
Sequence:CCGGATTGCGTCAGAGAACTCTATCCTCGAGGATAGAGTTCTCTGACGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081114.1-1286s21c1
Sequence:CCGGGATGGACTTCTCCCGTGTAACCTCGAGGTTACACGGGAGAAGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks