EMAIL THIS PAGE TO A FRIEND

CLIP4

CAP-GLY domain containing linker protein family, member 4

82 Gene Product Result for
Synonyms: RSNL2
Gene ID:
Mouse(78785) CAP-GLY domain containing linker protein family, member 4
Rat(298801) CAP-GLY domain containing linker protein family, member 4
chicken(428556) CAP-GLY domain containing linker protein family, member 4
dog(483020) CAP-GLY domain containing linker protein family, member 4
cow(515213) CAP-GLY domain containing linker protein family, member 4
Horse(100054786) CAP-GLY domain containing linker protein family, member 4
domestic cat(101091934) CAP-GLY domain containing linker protein family, member 4
domestic guinea pig(100729276) CAP-GLY domain containing linker protein family, member 4
naked mole-rat(101700836) CAP-GLY domain containing linker protein family, member 4
sheep(101102710) CAP-GLY domain containing linker protein family, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024692 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024692 Rosetta Predictions human pricing
NM_001013942 Rosetta Predictions rat pricing
NM_030179 Rosetta Predictions mouse pricing
NM_175378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186335 predicted 532
2 SASI_Hs01_00186336 predicted 1740
3 SASI_Hs01_00186337 predicted 1696
4 SASI_Hs01_00186339 predicted 1932
5 SASI_Hs01_00186340 predicted 2124
6 SASI_Hs01_00186341 predicted 713
7 SASI_Hs01_00186342 predicted 478
8 SASI_Hs02_00357141 predicted 258
9 SASI_Hs02_00357142 predicted 2176
10 SASI_Hs01_00186344 predicted 852
11 SASI_Hs01_00186338 predicted 922
12 SASI_Hs01_00186343 predicted 2275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201253 predicted 402
2 SASI_Rn01_00066718 predicted 502
3 SASI_Rn01_00066720 predicted 1426
4 SASI_Rn01_00066721 predicted 1761
5 SASI_Rn01_00066722 predicted 247
6 SASI_Rn01_00066723 predicted 563
7 SASI_Rn01_00066725 predicted 573
8 SASI_Rn02_00201254 predicted 688
9 SASI_Rn01_00066726 predicted 1144
10 SASI_Rn01_00066727 predicted 1467
11 SASI_Rn01_00066719 predicted 1658
12 SASI_Rn01_00066724 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049563 predicted 627
2 SASI_Mm01_00049564 predicted 599
3 SASI_Mm02_00336587 predicted 574
4 SASI_Mm01_00049567 predicted 507
5 SASI_Mm01_00049568 predicted 1653
6 SASI_Mm02_00336588 predicted 672
7 SASI_Mm02_00336589 predicted 530
8 SASI_Mm02_00336590 predicted 676
9 SASI_Mm02_00336591 predicted 703
10 SASI_Mm02_00336592 predicted 463
11 SASI_Mm01_00049565 predicted 1841
12 SASI_Mm01_00049566 predicted 220
13 SASI_Mm01_00049569 predicted 932
14 SASI_Mm01_00049570 predicted 296
15 SASI_Mm01_00049571 predicted 601
16 SASI_Mm01_00049572 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346200 predicted 716
2 SASI_Mm02_00346201 predicted 691
3 SASI_Mm02_00346202 predicted 669
4 SASI_Mm02_00346203 predicted 596
5 SASI_Mm02_00346204 predicted 1608
6 SASI_Mm02_00346205 predicted 769
7 SASI_Mm02_00346206 predicted 627
8 SASI_Mm02_00346207 predicted 766
9 SASI_Mm02_00346208 predicted 804
10 SASI_Mm02_00346209 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030179
CLIP4 MISSION shRNA Bacterial Glycerol Stock
CAP-GLY domain containing linker protein family, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030179.3-2333s21c1
Sequence:CCGGGGTTTACTTTACTTAGCTATTCTCGAGAATAGCTAAGTAAAGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-1741s21c1
Sequence:CCGGTTTAGTTGCTCTCCGAGATATCTCGAGATATCTCGGAGAGCAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-2139s21c1
Sequence:CCGGTGTGGGTGACAAGCGCTATTTCTCGAGAAATAGCGCTTGTCACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-492s21c1
Sequence:CCGGGGCTCATGGCATCGGTGATATCTCGAGATATCACCGATGCCATGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-674s21c1
Sequence:CCGGATGCCACTTGCAGCGACTTTACTCGAGTAAAGTCGCTGCAAGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030179
CLIP4 MISSION shRNA shRNA Plasmid DNA
CAP-GLY domain containing linker protein family, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030179.3-2333s21c1
Sequence:CCGGGGTTTACTTTACTTAGCTATTCTCGAGAATAGCTAAGTAAAGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-1741s21c1
Sequence:CCGGTTTAGTTGCTCTCCGAGATATCTCGAGATATCTCGGAGAGCAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-2139s21c1
Sequence:CCGGTGTGGGTGACAAGCGCTATTTCTCGAGAAATAGCGCTTGTCACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-492s21c1
Sequence:CCGGGGCTCATGGCATCGGTGATATCTCGAGATATCACCGATGCCATGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-674s21c1
Sequence:CCGGATGCCACTTGCAGCGACTTTACTCGAGTAAAGTCGCTGCAAGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030179
CLIP4 MISSION shRNA Lentiviral Transduction Particles
CAP-GLY domain containing linker protein family, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030179.3-2333s21c1
Sequence:CCGGGGTTTACTTTACTTAGCTATTCTCGAGAATAGCTAAGTAAAGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-1741s21c1
Sequence:CCGGTTTAGTTGCTCTCCGAGATATCTCGAGATATCTCGGAGAGCAACTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-2139s21c1
Sequence:CCGGTGTGGGTGACAAGCGCTATTTCTCGAGAAATAGCGCTTGTCACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-492s21c1
Sequence:CCGGGGCTCATGGCATCGGTGATATCTCGAGATATCACCGATGCCATGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030179.3-674s21c1
Sequence:CCGGATGCCACTTGCAGCGACTTTACTCGAGTAAAGTCGCTGCAAGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024692
VALIDATED
CLIP4 MISSION shRNA Bacterial Glycerol Stock
CAP-GLY domain containing linker protein family, member 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024692.3-2865s1c1
Sequence:CCGGGCCCTTTCAGAAATGCCTCATCTCGAGATGAGGCATTTCTGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024692.3-3473s1c1
Sequence:CCGGGCCTGTTACAAAGCTACAGAACTCGAGTTCTGTAGCTTTGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024692.3-2248s1c1
Sequence:CCGGCTATTTCACCTGTAAGCCGAACTCGAGTTCGGCTTACAGGTGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024692.3-3292s1c1
Sequence:CCGGCCTGGGATATGAGAAACATTTCTCGAGAAATGTTTCTCATATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024692.3-3711s1c1
Sequence:CCGGGCTTGCCTTGTGCTTAGAAATCTCGAGATTTCTAAGCACAAGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024692.3-1166s1c1
Sequence:CCGGGCTGGCATTGAACTGGATGAACTCGAGTTCATCCAGTTCAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024692
VALIDATED
CLIP4 MISSION shRNA shRNA Plasmid DNA
CAP-GLY domain containing linker protein family, member 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024692.3-2865s1c1
Sequence:CCGGGCCCTTTCAGAAATGCCTCATCTCGAGATGAGGCATTTCTGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024692.3-3473s1c1
Sequence:CCGGGCCTGTTACAAAGCTACAGAACTCGAGTTCTGTAGCTTTGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024692.3-2248s1c1
Sequence:CCGGCTATTTCACCTGTAAGCCGAACTCGAGTTCGGCTTACAGGTGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024692.3-3292s1c1
Sequence:CCGGCCTGGGATATGAGAAACATTTCTCGAGAAATGTTTCTCATATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024692.3-3711s1c1
Sequence:CCGGGCTTGCCTTGTGCTTAGAAATCTCGAGATTTCTAAGCACAAGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024692.3-1166s1c1
Sequence:CCGGGCTGGCATTGAACTGGATGAACTCGAGTTCATCCAGTTCAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024692
VALIDATED
CLIP4 MISSION shRNA Lentiviral Transduction Particles
CAP-GLY domain containing linker protein family, member 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138925    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024692.3-2865s1c1
Sequence:CCGGGCCCTTTCAGAAATGCCTCATCTCGAGATGAGGCATTTCTGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024692.3-3473s1c1
Sequence:CCGGGCCTGTTACAAAGCTACAGAACTCGAGTTCTGTAGCTTTGTAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024692.3-2248s1c1
Sequence:CCGGCTATTTCACCTGTAAGCCGAACTCGAGTTCGGCTTACAGGTGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024692.3-3292s1c1
Sequence:CCGGCCTGGGATATGAGAAACATTTCTCGAGAAATGTTTCTCATATCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024692.3-3711s1c1
Sequence:CCGGGCTTGCCTTGTGCTTAGAAATCTCGAGATTTCTAAGCACAAGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024692.3-1166s1c1
Sequence:CCGGGCTGGCATTGAACTGGATGAACTCGAGTTCATCCAGTTCAATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029080
CLIP4 MISSION shRNA Bacterial Glycerol Stock
CAP-GLY domain containing linker protein family, member 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-708s1c1
Sequence:CCGGCCTGCACATTGCAGCACATAACTCGAGTTATGTGCTGCAATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-2025s1c1
Sequence:CCGGGCTCACAAGCTCTAACGAAATCTCGAGATTTCGTTAGAGCTTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-1748s1c1
Sequence:CCGGGCTCTCCGAGATATGGAATATCTCGAGATATTCCATATCTCGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-1558s1c1
Sequence:CCGGGCAGCAAATAACAGTCACCATCTCGAGATGGTGACTGTTATTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029080
CLIP4 MISSION shRNA shRNA Plasmid DNA
CAP-GLY domain containing linker protein family, member 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-708s1c1
Sequence:CCGGCCTGCACATTGCAGCACATAACTCGAGTTATGTGCTGCAATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-2025s1c1
Sequence:CCGGGCTCACAAGCTCTAACGAAATCTCGAGATTTCGTTAGAGCTTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-1748s1c1
Sequence:CCGGGCTCTCCGAGATATGGAATATCTCGAGATATTCCATATCTCGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-1558s1c1
Sequence:CCGGGCAGCAAATAACAGTCACCATCTCGAGATGGTGACTGTTATTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029080
CLIP4 MISSION shRNA Lentiviral Transduction Particles
CAP-GLY domain containing linker protein family, member 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-708s1c1
Sequence:CCGGCCTGCACATTGCAGCACATAACTCGAGTTATGTGCTGCAATGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-2025s1c1
Sequence:CCGGGCTCACAAGCTCTAACGAAATCTCGAGATTTCGTTAGAGCTTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-1748s1c1
Sequence:CCGGGCTCTCCGAGATATGGAATATCTCGAGATATTCCATATCTCGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029080.1-1558s1c1
Sequence:CCGGGCAGCAAATAACAGTCACCATCTCGAGATGGTGACTGTTATTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks