EMAIL THIS PAGE TO A FRIEND

CLK1

CDC-like kinase 1

93 Gene Product Result for
Synonyms: CLK CLK/STY STY
UniProtKB ID: P49759, B4DFW7, Q0P694, Q8N5V8
Gene ID:
Human(1195) Summary: This gene encodes a member of the CDC2-like (or LAMMER) family of dual specificity protein kinases. In the nucleus, the encoded protein phosphorylates serine/arginine-rich proteins involved in pre-mRNA processing, releasing them into the nucleoplasm. The choice of splice sites during pre-mRNA processing may be regulated by the concentration of transacting factors, including serine/arginine rich proteins. Therefore, the encoded protein may play an indirect role in governing splice site selection. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Mouse(12747) CDC-like kinase 1
Rat(301434) CDC-like kinase 1
chicken(100858576) CDC-like kinase 1
dog(478866) CDC-like kinase 1
domestic cat(101092384) CDC-like kinase 1
Horse(100067832) CDC-like kinase 1
cow(613808) CDC-like kinase 1
domestic guinea pig(100719662) CDC-like kinase 1
naked mole-rat(101721135) CDC-like kinase 1
Goat(100861149) CDC-like kinase 1
sheep(101105634) CDC-like kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004071 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001042634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001042634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
14-920-M CLK1, active 10 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024646 Rosetta Predictions human pricing
NM_004071 Rosetta Predictions human pricing
NM_001106913 Rosetta Predictions rat pricing
NM_001042634 Rosetta Predictions mouse pricing
NM_009905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011838 predicted 254
2 SASI_Hs01_00011839 predicted 1015
3 SASI_Hs01_00011840 predicted 978
4 SASI_Hs01_00011841 predicted 981
5 SASI_Hs01_00011842 predicted 1014
6 SASI_Hs01_00011843 predicted 976
7 SASI_Hs01_00011844 predicted 259
8 SASI_Hs01_00011845 predicted 821
9 SASI_Hs01_00011846 predicted 928
10 SASI_Hs01_00011847 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336864 predicted 610
2 SASI_Hs02_00336865 predicted 685
3 SASI_Hs02_00336866 predicted 320
4 SASI_Hs01_00080567 predicted 1064
5 SASI_Hs01_00080568 predicted 248
6 SASI_Hs01_00080569 predicted 905
7 SASI_Hs01_00080570 predicted 1009
8 SASI_Hs01_00080572 predicted 1135
9 SASI_Hs01_00080573 predicted 1274
10 SASI_Hs01_00080574 predicted 1431
11 SASI_Hs01_00080565 predicted 1108
12 SASI_Hs01_00080566 predicted 1407
13 SASI_Hs01_00080571 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223636 predicted 1098
2 SASI_Rn02_00223637 predicted 1216
3 SASI_Rn02_00223638 predicted 1471
4 SASI_Rn02_00223639 predicted 1220
5 SASI_Rn02_00223640 predicted 998
6 SASI_Rn02_00223641 predicted 1060
7 SASI_Rn02_00223642 predicted 1127
8 SASI_Rn02_00223643 predicted 1053
9 SASI_Rn02_00223644 predicted 1117
10 SASI_Rn02_00223645 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290805 predicted 860
2 SASI_Mm02_00290806 predicted 1515
3 SASI_Mm02_00290807 predicted 1100
4 SASI_Mm02_00290808 predicted 1254
5 SASI_Mm02_00290809 predicted 1388
6 SASI_Mm02_00290810 predicted 944
7 SASI_Mm02_00290811 predicted 1090
8 SASI_Mm02_00290812 predicted 203
9 SASI_Mm02_00290813 predicted 1146
10 SASI_Mm02_00290814 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317416 predicted 772
2 SASI_Mm01_00127804 predicted 1007
3 SASI_Mm02_00317417 predicted 849
4 SASI_Mm01_00127805 predicted 856
5 SASI_Mm01_00127806 predicted 995
6 SASI_Mm02_00317418 predicted 324
7 SASI_Mm02_00317419 predicted 845
8 SASI_Mm02_00317420 predicted 766
9 SASI_Mm02_00317421 predicted 196
10 SASI_Mm01_00127810 predicted 877
11 SASI_Mm01_00127802 predicted 314
12 SASI_Mm01_00127803 predicted 734
13 SASI_Mm01_00127807 predicted 892
14 SASI_Mm01_00127808 predicted 968
15 SASI_Mm01_00127809 predicted 512
16 SASI_Mm01_00127811 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004071
VALIDATED
CLK1 MISSION shRNA Bacterial Glycerol Stock
CDC-like kinase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004071.2-1034s1c1
Sequence:CCGGGACTACACAGAGGCGTATAATCTCGAGATTATACGCCTCTGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004071.2-1715s1c1
Sequence:CCGGGTTTGGGTAATTTGGTTCATTCTCGAGAATGAACCAAATTACCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004071.2-1378s1c1
Sequence:CCGGCGATCGATTAGACTGGGATGACTCGAGTCATCCCAGTCTAATCGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004071.x-1746s1c1
Sequence:CCGGTGGTTCATTAAGTACATAGCTCTCGAGAGCTATGTACTTAATGAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004071.x-1435s1c1
Sequence:CCGGGATATGTTTCAAGAGCCTGTACTCGAGTACAGGCTCTTGAAACATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_004071.x-968s1c1
Sequence:CCGGGATATGCAAGTCTGTGAATTTCTCGAGAAATTCACAGACTTGCATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004071.x-762s1c1
Sequence:CCGGGCTCGCTCAGAAATACAAGTTCTCGAGAACTTGTATTTCTGAGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004071.x-283s1c1
Sequence:CCGGGCTGCAAATACAATCACTCTACTCGAGTAGAGTGATTGTATTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-706s21c1
Sequence:CCGGTGTGGAGTGCATCGATCATAACTCGAGTTATGATCGATGCACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-1078s21c1
Sequence:CCGGTGACTACACAGAGGCGTATAACTCGAGTTATACGCCTCTGTGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-1298s21c1
Sequence:CCGGTATCTTGGGTTTACCGTATTTCTCGAGAAATACGGTAAACCCAAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-1463s21c1
Sequence:CCGGTATGTTTCAAGACGCTGTAAACTCGAGTTTACAGCGTCTTGAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004071
VALIDATED
CLK1 MISSION shRNA shRNA Plasmid DNA
CDC-like kinase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004071.2-1034s1c1
Sequence:CCGGGACTACACAGAGGCGTATAATCTCGAGATTATACGCCTCTGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004071.2-1715s1c1
Sequence:CCGGGTTTGGGTAATTTGGTTCATTCTCGAGAATGAACCAAATTACCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004071.2-1378s1c1
Sequence:CCGGCGATCGATTAGACTGGGATGACTCGAGTCATCCCAGTCTAATCGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004071.x-1746s1c1
Sequence:CCGGTGGTTCATTAAGTACATAGCTCTCGAGAGCTATGTACTTAATGAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004071.x-1435s1c1
Sequence:CCGGGATATGTTTCAAGAGCCTGTACTCGAGTACAGGCTCTTGAAACATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_004071.x-968s1c1
Sequence:CCGGGATATGCAAGTCTGTGAATTTCTCGAGAAATTCACAGACTTGCATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004071.x-762s1c1
Sequence:CCGGGCTCGCTCAGAAATACAAGTTCTCGAGAACTTGTATTTCTGAGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004071.x-283s1c1
Sequence:CCGGGCTGCAAATACAATCACTCTACTCGAGTAGAGTGATTGTATTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-706s21c1
Sequence:CCGGTGTGGAGTGCATCGATCATAACTCGAGTTATGATCGATGCACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-1078s21c1
Sequence:CCGGTGACTACACAGAGGCGTATAACTCGAGTTATACGCCTCTGTGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-1298s21c1
Sequence:CCGGTATCTTGGGTTTACCGTATTTCTCGAGAAATACGGTAAACCCAAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-1463s21c1
Sequence:CCGGTATGTTTCAAGACGCTGTAAACTCGAGTTTACAGCGTCTTGAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004071
VALIDATED
CLK1 MISSION shRNA Lentiviral Transduction Particles
CDC-like kinase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004071.2-1034s1c1
Sequence:CCGGGACTACACAGAGGCGTATAATCTCGAGATTATACGCCTCTGTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004071.2-1715s1c1
Sequence:CCGGGTTTGGGTAATTTGGTTCATTCTCGAGAATGAACCAAATTACCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004071.2-1378s1c1
Sequence:CCGGCGATCGATTAGACTGGGATGACTCGAGTCATCCCAGTCTAATCGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004071.x-1746s1c1
Sequence:CCGGTGGTTCATTAAGTACATAGCTCTCGAGAGCTATGTACTTAATGAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004071.x-1435s1c1
Sequence:CCGGGATATGTTTCAAGAGCCTGTACTCGAGTACAGGCTCTTGAAACATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_004071.x-968s1c1
Sequence:CCGGGATATGCAAGTCTGTGAATTTCTCGAGAAATTCACAGACTTGCATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004071.x-762s1c1
Sequence:CCGGGCTCGCTCAGAAATACAAGTTCTCGAGAACTTGTATTTCTGAGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004071.x-283s1c1
Sequence:CCGGGCTGCAAATACAATCACTCTACTCGAGTAGAGTGATTGTATTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-706s21c1
Sequence:CCGGTGTGGAGTGCATCGATCATAACTCGAGTTATGATCGATGCACTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-1078s21c1
Sequence:CCGGTGACTACACAGAGGCGTATAACTCGAGTTATACGCCTCTGTGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-1298s21c1
Sequence:CCGGTATCTTGGGTTTACCGTATTTCTCGAGAAATACGGTAAACCCAAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004071.3-1463s21c1
Sequence:CCGGTATGTTTCAAGACGCTGTAAACTCGAGTTTACAGCGTCTTGAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009905
CLK1 MISSION shRNA Bacterial Glycerol Stock
CDC-like kinase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000023109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-240s1c1
Sequence:CCGGCAGACAGCTATTATCTGGAAACTCGAGTTTCCAGATAATAGCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-281s1c1
Sequence:CCGGGCTTATCATAGTCGACGCTATCTCGAGATAGCGTCGACTATGATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-129s1c1
Sequence:CCGGGAGACTGGGATTATGGAACATCTCGAGATGTTCCATAATCCCAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-297s1c1
Sequence:CCGGGCTATGTTGATGAATACAGGACTCGAGTCCTGTATTCATCAACATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009905
CLK1 MISSION shRNA shRNA Plasmid DNA
CDC-like kinase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000023109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-240s1c1
Sequence:CCGGCAGACAGCTATTATCTGGAAACTCGAGTTTCCAGATAATAGCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-281s1c1
Sequence:CCGGGCTTATCATAGTCGACGCTATCTCGAGATAGCGTCGACTATGATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-129s1c1
Sequence:CCGGGAGACTGGGATTATGGAACATCTCGAGATGTTCCATAATCCCAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-297s1c1
Sequence:CCGGGCTATGTTGATGAATACAGGACTCGAGTCCTGTATTCATCAACATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009905
CLK1 MISSION shRNA Lentiviral Transduction Particles
CDC-like kinase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000023109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-240s1c1
Sequence:CCGGCAGACAGCTATTATCTGGAAACTCGAGTTTCCAGATAATAGCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-281s1c1
Sequence:CCGGGCTTATCATAGTCGACGCTATCTCGAGATAGCGTCGACTATGATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-129s1c1
Sequence:CCGGGAGACTGGGATTATGGAACATCTCGAGATGTTCCATAATCCCAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009905.1-297s1c1
Sequence:CCGGGCTATGTTGATGAATACAGGACTCGAGTCCTGTATTCATCAACATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042634
CLK1 MISSION shRNA Bacterial Glycerol Stock
CDC-like kinase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042634.2-1622s21c1
Sequence:CCGGTTTATAAACACAGTGCTCTGACTCGAGTCAGAGCACTGTGTTTATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-767s21c1
Sequence:CCGGGAAGCTGCTCAATCGGAAATACTCGAGTATTTCCGATTGAGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-691s21c1
Sequence:CCGGGGTGGAATGCATCGATCATAACTCGAGTTATGATCGATGCATTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-940s21c1
Sequence:CCGGGCCGTTTCGAATGGATCATATCTCGAGATATGATCCATTCGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042634.2-1644s21c1
Sequence:CCGGAGGAATCTTACAGACTGTATCCTCGAGGATACAGTCTGTAAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-1099s21c1
Sequence:CCGGTGATGAACGTACTATAGTAAACTCGAGTTTACTATAGTACGTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-1063s21c1
Sequence:CCGGTGACTACACAGAGGCTTATAACTCGAGTTATAAGCCTCTGTGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-1448s21c1
Sequence:CCGGTATGTTTCTCGGCGCTGTAAACTCGAGTTTACAGCGCCGAGAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042634
CLK1 MISSION shRNA shRNA Plasmid DNA
CDC-like kinase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042634.2-1622s21c1
Sequence:CCGGTTTATAAACACAGTGCTCTGACTCGAGTCAGAGCACTGTGTTTATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-767s21c1
Sequence:CCGGGAAGCTGCTCAATCGGAAATACTCGAGTATTTCCGATTGAGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-691s21c1
Sequence:CCGGGGTGGAATGCATCGATCATAACTCGAGTTATGATCGATGCATTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-940s21c1
Sequence:CCGGGCCGTTTCGAATGGATCATATCTCGAGATATGATCCATTCGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042634.2-1644s21c1
Sequence:CCGGAGGAATCTTACAGACTGTATCCTCGAGGATACAGTCTGTAAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-1099s21c1
Sequence:CCGGTGATGAACGTACTATAGTAAACTCGAGTTTACTATAGTACGTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-1063s21c1
Sequence:CCGGTGACTACACAGAGGCTTATAACTCGAGTTATAAGCCTCTGTGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-1448s21c1
Sequence:CCGGTATGTTTCTCGGCGCTGTAAACTCGAGTTTACAGCGCCGAGAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042634
CLK1 MISSION shRNA Lentiviral Transduction Particles
CDC-like kinase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042634.2-1622s21c1
Sequence:CCGGTTTATAAACACAGTGCTCTGACTCGAGTCAGAGCACTGTGTTTATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-767s21c1
Sequence:CCGGGAAGCTGCTCAATCGGAAATACTCGAGTATTTCCGATTGAGCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-691s21c1
Sequence:CCGGGGTGGAATGCATCGATCATAACTCGAGTTATGATCGATGCATTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-940s21c1
Sequence:CCGGGCCGTTTCGAATGGATCATATCTCGAGATATGATCCATTCGAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042634.2-1644s21c1
Sequence:CCGGAGGAATCTTACAGACTGTATCCTCGAGGATACAGTCTGTAAGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-1099s21c1
Sequence:CCGGTGATGAACGTACTATAGTAAACTCGAGTTTACTATAGTACGTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-1063s21c1
Sequence:CCGGTGACTACACAGAGGCTTATAACTCGAGTTATAAGCCTCTGTGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042634.2-1448s21c1
Sequence:CCGGTATGTTTCTCGGCGCTGTAAACTCGAGTTTACAGCGCCGAGAAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks