EMAIL THIS PAGE TO A FRIEND

CLK2

CDC-like kinase 2

Synonyms: hCLK2
UniProtKB ID: P49760, B1AVS9, B5MBX6, Q96CQ0
Gene ID:
Human(1196) Summary: This gene encodes a member of the CLK family of dual specificity protein kinases. CLK family members have been shown to interact with, and phosphorylate, serine- and arginine-rich (SR) proteins of the spliceosomal complex, which is a part of the regulatory mechanism that enables the SR proteins to control RNA splicing. Note that this gene is distinct from TELO2 gene (GeneID:9894), which shares CLK2 and hCLK2 symbol aliases in common with this gene, but encodes a protein that is involved in telomere length regulation. [provided by RefSeq, Jul 2008]
Mouse(12748) CDC-like kinase 2
Rat(365842) CDC-like kinase 2
sheep(101118834) CDC-like kinase 2
naked mole-rat(101702078) CDC-like kinase 2
domestic guinea pig(100716196) CDC-like kinase 2
chicken(425060) CDC-like kinase 2
dog(490427) CDC-like kinase 2
Horse(100063546) CDC-like kinase 2
cow(512737) CDC-like kinase 2
domestic cat(101088998) CDC-like kinase 2
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003993 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001291 Rosetta Predictions human pricing
NM_003993 Rosetta Predictions human pricing
NM_001014254 Rosetta Predictions rat pricing
NM_007712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220216 predicted 446
2 SASI_Hs01_00220217 predicted 374
3 SASI_Hs01_00220218 predicted 447
4 SASI_Hs01_00220219 predicted 435
5 SASI_Hs01_00220220 predicted 365
6 SASI_Hs01_00220221 predicted 455
7 SASI_Hs01_00220222 predicted 366
8 SASI_Hs01_00220223 predicted 940
9 SASI_Hs01_00220224 predicted 1186
10 SASI_Hs01_00220225 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336705 predicted 549
2 SASI_Hs01_00011858 predicted 1771
3 SASI_Hs01_00011859 predicted 374
4 SASI_Hs02_00336706 predicted 908
5 SASI_Hs02_00336707 predicted 935
6 SASI_Hs02_00336708 predicted 900
7 SASI_Hs01_00011861 predicted 1670
8 SASI_Hs02_00336709 predicted 1361
9 SASI_Hs01_00011862 predicted 1555
10 SASI_Hs01_00011864 predicted 1448
11 SASI_Hs01_00011860 predicted 363
12 SASI_Hs01_00011863 predicted 1398
13 SASI_Hs01_00011865 predicted 1279
14 SASI_Hs01_00011866 predicted 1120
15 SASI_Hs01_00011867 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108616 predicted 460
2 SASI_Rn01_00108617 predicted 1749
3 SASI_Rn01_00108619 predicted 437
4 SASI_Rn01_00108620 predicted 1428
5 SASI_Rn01_00108621 predicted 1427
6 SASI_Rn01_00108622 predicted 688
7 SASI_Rn01_00108623 predicted 572
8 SASI_Rn01_00108624 predicted 1167
9 SASI_Rn01_00108625 predicted 1279
10 SASI_Rn02_00201821 predicted 1281
11 SASI_Rn01_00108618 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111730 predicted 495
2 SASI_Mm01_00111731 predicted 1176
3 SASI_Mm01_00111732 predicted 286
4 SASI_Mm01_00111733 predicted 1012
5 SASI_Mm01_00111734 predicted 332
6 SASI_Mm01_00111735 predicted 1037
7 SASI_Mm01_00111736 predicted 628
8 SASI_Mm01_00111737 predicted 956
9 SASI_Mm01_00111738 predicted 392
10 SASI_Mm01_00111739 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003993
VALIDATED
CLK2 MISSION shRNA Bacterial Glycerol Stock
CDC-like kinase 2
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-353s21c1
Sequence:CCGGCTATCGGAGCCGAAAGCATAACTCGAGTTATGCTTTCGGCTCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-854s21c1
Sequence:GTACCGGAGTTGCCCTGAAGATCATTAACTCGAGTTAATGATCTTCAGGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003993.2-1888s21c1
Sequence:CCGGTTCCTCCTGGCTCTCTATATACTCGAGTATATAGAGAGCCAGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-1025s21c1
Sequence:CCGGGGGCCTTAGCACCTTCGATTTCTCGAGAAATCGAAGGTGCTAAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-572s21c1
Sequence:CCGGCTATCGGCATTCCTATGAATACTCGAGTATTCATAGGAATGCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003993.2-517s21c1
Sequence:CCGGGCTACAGACGCAACGATTATACTCGAGTATAATCGTTGCGTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003993.2-447s21c1
Sequence:CCGGGTCCGTTCTCGAAGCAGTTATCTCGAGATAACTGCTTCGAGAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-904s21c1
Sequence:CCGGGACTTGAGATCAACGTGCTAGCTCGAGCTAGCACGTTGATCTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-1773s21c1
Sequence:CCGGGATATCAGTCGGTGACGATCACTCGAGTGATCGTCACCGACTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003993.2-1870s1c1
Sequence:CCGGCGAGCCAGAGTTCACTCCTTCCTCGAGGAAGGAGTGAACTCTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003993.2-1969s1c1
Sequence:CCGGGCCTTGTACATAATACTATTCCTCGAGGAATAGTATTATGTACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003993.2-572s1c1
Sequence:CCGGCTATCGGCATTCCTATGAATACTCGAGTATTCATAGGAATGCCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.2-945s1c1
Sequence:CCGGCCTGACAACAAGAACCTCTGTCTCGAGACAGAGGTTCTTGTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003993.2-1640s1c1
Sequence:CCGGGCTCTTCGATCTGATTGAAAGCTCGAGCTTTCAATCAGATCGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-1221s1c1
Sequence:CCGGGTGGAGTATAGGCTGCATCATCTCGAGATGATGCAGCCTATACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-296s1c1
Sequence:CCGGGAAGCAGTTATGATGATCGTTCTCGAGAACGATCATCATAACTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-203s1c1
Sequence:CCGGGAAAGCATAAGCGACGAAGAACTCGAGTTCTTCGTCGCTTATGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-751s1c1
Sequence:CCGGGAGATCAACGTGCTAGAGAAACTCGAGTTTCTCTAGCACGTTGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003993.x-1729s1c1
Sequence:CCGGCTTCCTCCTGGCTCTCTATATCTCGAGATATAGAGAGCCAGGAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003993
VALIDATED
CLK2 MISSION shRNA shRNA Plasmid DNA
CDC-like kinase 2
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-353s21c1
Sequence:CCGGCTATCGGAGCCGAAAGCATAACTCGAGTTATGCTTTCGGCTCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-854s21c1
Sequence:GTACCGGAGTTGCCCTGAAGATCATTAACTCGAGTTAATGATCTTCAGGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003993.2-1888s21c1
Sequence:CCGGTTCCTCCTGGCTCTCTATATACTCGAGTATATAGAGAGCCAGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-1025s21c1
Sequence:CCGGGGGCCTTAGCACCTTCGATTTCTCGAGAAATCGAAGGTGCTAAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-572s21c1
Sequence:CCGGCTATCGGCATTCCTATGAATACTCGAGTATTCATAGGAATGCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003993.2-517s21c1
Sequence:CCGGGCTACAGACGCAACGATTATACTCGAGTATAATCGTTGCGTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003993.2-447s21c1
Sequence:CCGGGTCCGTTCTCGAAGCAGTTATCTCGAGATAACTGCTTCGAGAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-904s21c1
Sequence:CCGGGACTTGAGATCAACGTGCTAGCTCGAGCTAGCACGTTGATCTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-1773s21c1
Sequence:CCGGGATATCAGTCGGTGACGATCACTCGAGTGATCGTCACCGACTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003993.2-1870s1c1
Sequence:CCGGCGAGCCAGAGTTCACTCCTTCCTCGAGGAAGGAGTGAACTCTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003993.2-1969s1c1
Sequence:CCGGGCCTTGTACATAATACTATTCCTCGAGGAATAGTATTATGTACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003993.2-572s1c1
Sequence:CCGGCTATCGGCATTCCTATGAATACTCGAGTATTCATAGGAATGCCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.2-945s1c1
Sequence:CCGGCCTGACAACAAGAACCTCTGTCTCGAGACAGAGGTTCTTGTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003993.2-1640s1c1
Sequence:CCGGGCTCTTCGATCTGATTGAAAGCTCGAGCTTTCAATCAGATCGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-1221s1c1
Sequence:CCGGGTGGAGTATAGGCTGCATCATCTCGAGATGATGCAGCCTATACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-296s1c1
Sequence:CCGGGAAGCAGTTATGATGATCGTTCTCGAGAACGATCATCATAACTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-203s1c1
Sequence:CCGGGAAAGCATAAGCGACGAAGAACTCGAGTTCTTCGTCGCTTATGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-751s1c1
Sequence:CCGGGAGATCAACGTGCTAGAGAAACTCGAGTTTCTCTAGCACGTTGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003993.x-1729s1c1
Sequence:CCGGCTTCCTCCTGGCTCTCTATATCTCGAGATATAGAGAGCCAGGAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003993
VALIDATED
CLK2 MISSION shRNA Lentiviral Transduction Particles
CDC-like kinase 2
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-353s21c1
Sequence:CCGGCTATCGGAGCCGAAAGCATAACTCGAGTTATGCTTTCGGCTCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-854s21c1
Sequence:GTACCGGAGTTGCCCTGAAGATCATTAACTCGAGTTAATGATCTTCAGGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003993.2-1888s21c1
Sequence:CCGGTTCCTCCTGGCTCTCTATATACTCGAGTATATAGAGAGCCAGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-1025s21c1
Sequence:CCGGGGGCCTTAGCACCTTCGATTTCTCGAGAAATCGAAGGTGCTAAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-572s21c1
Sequence:CCGGCTATCGGCATTCCTATGAATACTCGAGTATTCATAGGAATGCCGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003993.2-517s21c1
Sequence:CCGGGCTACAGACGCAACGATTATACTCGAGTATAATCGTTGCGTCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003993.2-447s21c1
Sequence:CCGGGTCCGTTCTCGAAGCAGTTATCTCGAGATAACTGCTTCGAGAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-904s21c1
Sequence:CCGGGACTTGAGATCAACGTGCTAGCTCGAGCTAGCACGTTGATCTCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003993.2-1773s21c1
Sequence:CCGGGATATCAGTCGGTGACGATCACTCGAGTGATCGTCACCGACTGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199189    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003993.2-1870s1c1
Sequence:CCGGCGAGCCAGAGTTCACTCCTTCCTCGAGGAAGGAGTGAACTCTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003993.2-1969s1c1
Sequence:CCGGGCCTTGTACATAATACTATTCCTCGAGGAATAGTATTATGTACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003993.2-572s1c1
Sequence:CCGGCTATCGGCATTCCTATGAATACTCGAGTATTCATAGGAATGCCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.2-945s1c1
Sequence:CCGGCCTGACAACAAGAACCTCTGTCTCGAGACAGAGGTTCTTGTTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003993.2-1640s1c1
Sequence:CCGGGCTCTTCGATCTGATTGAAAGCTCGAGCTTTCAATCAGATCGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-1221s1c1
Sequence:CCGGGTGGAGTATAGGCTGCATCATCTCGAGATGATGCAGCCTATACTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-296s1c1
Sequence:CCGGGAAGCAGTTATGATGATCGTTCTCGAGAACGATCATCATAACTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-203s1c1
Sequence:CCGGGAAAGCATAAGCGACGAAGAACTCGAGTTCTTCGTCGCTTATGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003993.x-751s1c1
Sequence:CCGGGAGATCAACGTGCTAGAGAAACTCGAGTTTCTCTAGCACGTTGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003993.x-1729s1c1
Sequence:CCGGCTTCCTCCTGGCTCTCTATATCTCGAGATATAGAGAGCCAGGAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007712
VALIDATED
CLK2 MISSION shRNA Bacterial Glycerol Stock
CDC-like kinase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-957s21c1
Sequence:CCGGGCGAGATGAGCGCAGTGTAAACTCGAGTTTACACTGCGCTCATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-327s21c1
Sequence:CCGGCCATCGAGAGAACAGCAGTTACTCGAGTAACTGCTGTTCTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-1041s21c1
Sequence:CCGGCATTGTCTCCACTCGCCATTACTCGAGTAATGGCGAGTGGAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-588s21c1
Sequence:CCGGAGTTGCCCTGAAGATCATTAACTCGAGTTAATGATCTTCAGGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-759s21c1
Sequence:CCGGGGGCCTTAGCACCTTCGATTTCTCGAGAAATCGAAGGTGCTAAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-95s1c1
Sequence:CCGGGCCGAAAGCATAAGCGAAGAACTCGAGTTCTTCGCTTATGCTTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007712.1-327s1c1
Sequence:CCGGCCATCGAGAGAACAGCAGTTACTCGAGTAACTGCTGTTCTCTCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-1372s1c1
Sequence:CCGGCAGCTCTTCGATCTGATTGAACTCGAGTTCAATCAGATCGAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-865s1c1
Sequence:CCGGCATGATAACAAGTTGACACATCTCGAGATGTGTCAACTTGTTATCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-310s1c1
Sequence:CCGGCGGCAGTCCTATGAATACCATCTCGAGATGGTATTCATAGGACTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007712
VALIDATED
CLK2 MISSION shRNA shRNA Plasmid DNA
CDC-like kinase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-957s21c1
Sequence:CCGGGCGAGATGAGCGCAGTGTAAACTCGAGTTTACACTGCGCTCATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-327s21c1
Sequence:CCGGCCATCGAGAGAACAGCAGTTACTCGAGTAACTGCTGTTCTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-1041s21c1
Sequence:CCGGCATTGTCTCCACTCGCCATTACTCGAGTAATGGCGAGTGGAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-588s21c1
Sequence:CCGGAGTTGCCCTGAAGATCATTAACTCGAGTTAATGATCTTCAGGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-759s21c1
Sequence:CCGGGGGCCTTAGCACCTTCGATTTCTCGAGAAATCGAAGGTGCTAAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-95s1c1
Sequence:CCGGGCCGAAAGCATAAGCGAAGAACTCGAGTTCTTCGCTTATGCTTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007712.1-327s1c1
Sequence:CCGGCCATCGAGAGAACAGCAGTTACTCGAGTAACTGCTGTTCTCTCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-1372s1c1
Sequence:CCGGCAGCTCTTCGATCTGATTGAACTCGAGTTCAATCAGATCGAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-865s1c1
Sequence:CCGGCATGATAACAAGTTGACACATCTCGAGATGTGTCAACTTGTTATCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-310s1c1
Sequence:CCGGCGGCAGTCCTATGAATACCATCTCGAGATGGTATTCATAGGACTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007712
VALIDATED
CLK2 MISSION shRNA Lentiviral Transduction Particles
CDC-like kinase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-957s21c1
Sequence:CCGGGCGAGATGAGCGCAGTGTAAACTCGAGTTTACACTGCGCTCATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-327s21c1
Sequence:CCGGCCATCGAGAGAACAGCAGTTACTCGAGTAACTGCTGTTCTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-1041s21c1
Sequence:CCGGCATTGTCTCCACTCGCCATTACTCGAGTAATGGCGAGTGGAGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-588s21c1
Sequence:CCGGAGTTGCCCTGAAGATCATTAACTCGAGTTAATGATCTTCAGGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007712.2-759s21c1
Sequence:CCGGGGGCCTTAGCACCTTCGATTTCTCGAGAAATCGAAGGTGCTAAGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-95s1c1
Sequence:CCGGGCCGAAAGCATAAGCGAAGAACTCGAGTTCTTCGCTTATGCTTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007712.1-327s1c1
Sequence:CCGGCCATCGAGAGAACAGCAGTTACTCGAGTAACTGCTGTTCTCTCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-1372s1c1
Sequence:CCGGCAGCTCTTCGATCTGATTGAACTCGAGTTCAATCAGATCGAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-865s1c1
Sequence:CCGGCATGATAACAAGTTGACACATCTCGAGATGTGTCAACTTGTTATCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007712.1-310s1c1
Sequence:CCGGCGGCAGTCCTATGAATACCATCTCGAGATGGTATTCATAGGACTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks