EMAIL THIS PAGE TO A FRIEND

CLK3

CDC-like kinase 3

117 Gene Product Result for
Synonyms: PHCLK3 PHCLK3/152
UniProtKB ID: P49761, D3DW59, Q53Y48, Q9BRS3, Q9BUJ7
Gene ID:
Human(1198) Summary: This gene encodes a protein belonging to the serine/threonine type protein kinase family. This protein is a nuclear dual-specificity kinase that regulates the intranuclear distribution of the serine/arginine-rich (SR) family of splicing factors. Two transcript variants encoding different isoforms have been found for this gene. Related pseudogenes are located on chromosomes 1 and 9. [provided by RefSeq, Jul 2008]
Mouse(102414) CDC-like kinase 3
Rat(171305) CDC-like kinase 3
chicken(415295) CDC-like kinase 3
dog(478367) CDC-like kinase 3
domestic cat(101083851) CDC-like kinase 3
Horse(100062320) CDC-like kinase 3
cow(505499) CDC-like kinase 3
domestic guinea pig(100715660) CDC-like kinase 3
naked mole-rat(101701166) CDC-like kinase 3
sheep(101109742) CDC-like kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003992 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001292 Rosetta Predictions human pricing
NM_003992 Rosetta Predictions human pricing
NM_134340 Rosetta Predictions rat pricing
NM_007713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075104 predicted 642
2 SASI_Hs01_00075105 predicted 880
3 SASI_Hs01_00075106 predicted 695
4 SASI_Hs01_00075107 predicted 745
5 SASI_Hs01_00075108 predicted 804
6 SASI_Hs01_00075109 predicted 634
7 SASI_Hs01_00075110 predicted 771
8 SASI_Hs01_00075111 predicted 702
9 SASI_Hs01_00075112 predicted 953
10 SASI_Hs01_00075113 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336698 predicted 1962
2 SASI_Hs01_00149785 predicted 1063
3 SASI_Hs01_00149786 predicted 1202
4 SASI_Hs01_00149789 predicted 1388
5 SASI_Hs02_00336699 predicted 1726
6 SASI_Hs02_00336700 predicted 591
7 SASI_Hs02_00336701 predicted 1116
8 SASI_Hs02_00336702 predicted 399
9 SASI_Hs02_00336703 predicted 1411
10 SASI_Hs02_00336704 predicted 1079
11 SASI_Hs01_00149780 predicted 745
12 SASI_Hs01_00149781 predicted 1338
13 SASI_Hs01_00149782 predicted 1247
14 SASI_Hs01_00149783 predicted 1289
15 SASI_Hs01_00149784 predicted 908
16 SASI_Hs01_00149787 predicted 804
17 SASI_Hs01_00149788 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044588 predicted 853
2 SASI_Rn01_00044590 predicted 738
3 SASI_Rn01_00044591 predicted 251
4 SASI_Rn01_00044594 predicted 962
5 SASI_Rn01_00044595 predicted 1066
6 SASI_Rn01_00044596 predicted 642
7 SASI_Rn01_00044597 predicted 203
8 SASI_Rn02_00267892 predicted 1160
9 SASI_Rn02_00267893 predicted 648
10 SASI_Rn02_00267894 predicted 1382
11 SASI_Rn01_00044589 predicted 1027
12 SASI_Rn01_00044592 predicted 805
13 SASI_Rn01_00044593 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171472 predicted 1451
2 SASI_Mm01_00171473 predicted 1578
3 SASI_Mm01_00171474 predicted 791
4 SASI_Mm01_00171475 predicted 1468
5 SASI_Mm02_00312279 predicted 2063
6 SASI_Mm01_00171476 predicted 1690
7 SASI_Mm01_00171477 predicted 1750
8 SASI_Mm01_00171478 predicted 1379
9 SASI_Mm01_00171480 predicted 1385
10 SASI_Mm01_00171481 predicted 1758
11 SASI_Mm01_00171479 predicted 1897
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003992
VALIDATED
CLK3 MISSION shRNA Bacterial Glycerol Stock
CDC-like kinase 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003992.1-186s1c1
Sequence:CCGGCCACGAAGATCTCGGTCCAGACTCGAGTCTGGACCGAGATCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.1-1141s1c1
Sequence:CCGGGCATTCTCTTTGAGTACTACCCTCGAGGGTAGTACTCAAAGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003992.1-1265s1c1
Sequence:CCGGGCAGAAATATTTCTACAAAGGCTCGAGCCTTTGTAGAAATATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.1-866s1c1
Sequence:CCGGCCTTAGATTTCTGCATGAGAACTCGAGTTCTCATGCAGAAATCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.1-289s1c1
Sequence:CCGGCCTTTGGAGAGGACTACTATGCTCGAGCATAGTAGTCCTCTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.x-1133s1c1
Sequence:CCGGCATTGGCTGCATTCTCTTTGACTCGAGTCAAAGAGAATGCAGCCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003992.x-301s1c1
Sequence:CCGGACTACTATGGACCTTCACGTTCTCGAGAACGTGAAGGTCCATAGTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003992.x-707s1c1
Sequence:CCGGCCTGTGTGTCTTGATGTCTGACTCGAGTCAGACATCAAGACACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003992.x-653s1c1
Sequence:CCGGGCTAGAAATCAACGTGCTCAACTCGAGTTGAGCACGTTGATTTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.x-1253s1c1
Sequence:CCGGCCGTACCAGGAAGCAGAAATACTCGAGTATTTCTGCTTCCTGGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-1131s21c1
Sequence:CCGGGCATTGGCTGCATTCTCTTTGCTCGAGCAAAGAGAATGCAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-854s21c1
Sequence:CCGGCTCTGCCACGCCCTTAGATTTCTCGAGAAATCTAAGGGCGTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-1400s21c1
Sequence:CCGGATGAGGAGGATGTTAGAATTTCTCGAGAAATTCTAACATCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-939s21c1
Sequence:CCGGAGTTTGAAACCCTCTACAATGCTCGAGCATTGTAGAGGGTTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003992
VALIDATED
CLK3 MISSION shRNA shRNA Plasmid DNA
CDC-like kinase 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003992.1-186s1c1
Sequence:CCGGCCACGAAGATCTCGGTCCAGACTCGAGTCTGGACCGAGATCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.1-1141s1c1
Sequence:CCGGGCATTCTCTTTGAGTACTACCCTCGAGGGTAGTACTCAAAGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003992.1-1265s1c1
Sequence:CCGGGCAGAAATATTTCTACAAAGGCTCGAGCCTTTGTAGAAATATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.1-866s1c1
Sequence:CCGGCCTTAGATTTCTGCATGAGAACTCGAGTTCTCATGCAGAAATCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.1-289s1c1
Sequence:CCGGCCTTTGGAGAGGACTACTATGCTCGAGCATAGTAGTCCTCTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.x-1133s1c1
Sequence:CCGGCATTGGCTGCATTCTCTTTGACTCGAGTCAAAGAGAATGCAGCCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003992.x-301s1c1
Sequence:CCGGACTACTATGGACCTTCACGTTCTCGAGAACGTGAAGGTCCATAGTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003992.x-707s1c1
Sequence:CCGGCCTGTGTGTCTTGATGTCTGACTCGAGTCAGACATCAAGACACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003992.x-653s1c1
Sequence:CCGGGCTAGAAATCAACGTGCTCAACTCGAGTTGAGCACGTTGATTTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.x-1253s1c1
Sequence:CCGGCCGTACCAGGAAGCAGAAATACTCGAGTATTTCTGCTTCCTGGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-1131s21c1
Sequence:CCGGGCATTGGCTGCATTCTCTTTGCTCGAGCAAAGAGAATGCAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-854s21c1
Sequence:CCGGCTCTGCCACGCCCTTAGATTTCTCGAGAAATCTAAGGGCGTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-1400s21c1
Sequence:CCGGATGAGGAGGATGTTAGAATTTCTCGAGAAATTCTAACATCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-939s21c1
Sequence:CCGGAGTTTGAAACCCTCTACAATGCTCGAGCATTGTAGAGGGTTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003992
VALIDATED
CLK3 MISSION shRNA Lentiviral Transduction Particles
CDC-like kinase 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003992.1-186s1c1
Sequence:CCGGCCACGAAGATCTCGGTCCAGACTCGAGTCTGGACCGAGATCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.1-1141s1c1
Sequence:CCGGGCATTCTCTTTGAGTACTACCCTCGAGGGTAGTACTCAAAGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003992.1-1265s1c1
Sequence:CCGGGCAGAAATATTTCTACAAAGGCTCGAGCCTTTGTAGAAATATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.1-866s1c1
Sequence:CCGGCCTTAGATTTCTGCATGAGAACTCGAGTTCTCATGCAGAAATCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.1-289s1c1
Sequence:CCGGCCTTTGGAGAGGACTACTATGCTCGAGCATAGTAGTCCTCTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.x-1133s1c1
Sequence:CCGGCATTGGCTGCATTCTCTTTGACTCGAGTCAAAGAGAATGCAGCCAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003992.x-301s1c1
Sequence:CCGGACTACTATGGACCTTCACGTTCTCGAGAACGTGAAGGTCCATAGTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003992.x-707s1c1
Sequence:CCGGCCTGTGTGTCTTGATGTCTGACTCGAGTCAGACATCAAGACACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003992.x-653s1c1
Sequence:CCGGGCTAGAAATCAACGTGCTCAACTCGAGTTGAGCACGTTGATTTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003992.x-1253s1c1
Sequence:CCGGCCGTACCAGGAAGCAGAAATACTCGAGTATTTCTGCTTCCTGGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-1131s21c1
Sequence:CCGGGCATTGGCTGCATTCTCTTTGCTCGAGCAAAGAGAATGCAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-854s21c1
Sequence:CCGGCTCTGCCACGCCCTTAGATTTCTCGAGAAATCTAAGGGCGTGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-1400s21c1
Sequence:CCGGATGAGGAGGATGTTAGAATTTCTCGAGAAATTCTAACATCCTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003992.4-939s21c1
Sequence:CCGGAGTTTGAAACCCTCTACAATGCTCGAGCATTGTAGAGGGTTTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007713
VALIDATED
CLK3 MISSION shRNA Bacterial Glycerol Stock
CDC-like kinase 3
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007713.2-613s1c1
Sequence:CCGGGCCCTGAAGATCATCCGTAATCTCGAGATTACGGATGATCTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007713.2-145s1c1
Sequence:CCGGCGGGAGCATGAAGGTCGACTACTCGAGTAGTCGACCTTCATGCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007713.2-873s1c1
Sequence:CCGGCCTTAGATTTCTACACGAGAACTCGAGTTCTCGTGTAGAAATCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007713.2-981s1c1
Sequence:CCGGCGAGGAGAAGTCAGTGAAGAACTCGAGTTCTTCACTGACTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007713.2-1033s1c1
Sequence:CCGGGCCACGTTTGACCATGAACATCTCGAGATGTTCATGGTCAAACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007713.4-2280s21c1
Sequence:CCGGGAAGAGTTGGAGAGCTGGACTCTCGAGAGTCCAGCTCTCCAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007713.4-1375s21c1
Sequence:CCGGAGCTGCTCGTCTAGAAATTAACTCGAGTTAATTTCTAGACGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007713.4-2272s21c1
Sequence:CCGGCAGCACACGAAGAGTTGGAGACTCGAGTCTCCAACTCTTCGTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-1881s21c1
Sequence:CCGGTTGAGTACTACCGTGGCTTTACTCGAGTAAAGCCACGGTAGTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-1462s21c1
Sequence:CCGGGTTCAACTTCCATGGTCATATCTCGAGATATGACCATGGAAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-1337s21c1
Sequence:CCGGGCCCTGAAGATCATCCGTAATCTCGAGATTACGGATGATCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-933s21c1
Sequence:CCGGCCAGAAGCCATGATCGTATACCTCGAGGTATACGATCATGGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007713.4-1350s21c1
Sequence:CCGGTCCGTAATGTGGGCAAGTATCCTCGAGGATACTTGCCCACATTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007713.4-1586s21c1
Sequence:CCGGCTCTGTCATGCCCTTAGATTTCTCGAGAAATCTAAGGGCATGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007713
VALIDATED
CLK3 MISSION shRNA shRNA Plasmid DNA
CDC-like kinase 3
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007713.2-613s1c1
Sequence:CCGGGCCCTGAAGATCATCCGTAATCTCGAGATTACGGATGATCTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007713.2-145s1c1
Sequence:CCGGCGGGAGCATGAAGGTCGACTACTCGAGTAGTCGACCTTCATGCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007713.2-873s1c1
Sequence:CCGGCCTTAGATTTCTACACGAGAACTCGAGTTCTCGTGTAGAAATCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007713.2-981s1c1
Sequence:CCGGCGAGGAGAAGTCAGTGAAGAACTCGAGTTCTTCACTGACTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007713.2-1033s1c1
Sequence:CCGGGCCACGTTTGACCATGAACATCTCGAGATGTTCATGGTCAAACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007713.4-2280s21c1
Sequence:CCGGGAAGAGTTGGAGAGCTGGACTCTCGAGAGTCCAGCTCTCCAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007713.4-1375s21c1
Sequence:CCGGAGCTGCTCGTCTAGAAATTAACTCGAGTTAATTTCTAGACGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007713.4-2272s21c1
Sequence:CCGGCAGCACACGAAGAGTTGGAGACTCGAGTCTCCAACTCTTCGTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-1881s21c1
Sequence:CCGGTTGAGTACTACCGTGGCTTTACTCGAGTAAAGCCACGGTAGTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-1462s21c1
Sequence:CCGGGTTCAACTTCCATGGTCATATCTCGAGATATGACCATGGAAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-1337s21c1
Sequence:CCGGGCCCTGAAGATCATCCGTAATCTCGAGATTACGGATGATCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-933s21c1
Sequence:CCGGCCAGAAGCCATGATCGTATACCTCGAGGTATACGATCATGGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007713.4-1350s21c1
Sequence:CCGGTCCGTAATGTGGGCAAGTATCCTCGAGGATACTTGCCCACATTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007713.4-1586s21c1
Sequence:CCGGCTCTGTCATGCCCTTAGATTTCTCGAGAAATCTAAGGGCATGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007713
VALIDATED
CLK3 MISSION shRNA Lentiviral Transduction Particles
CDC-like kinase 3
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007713.2-613s1c1
Sequence:CCGGGCCCTGAAGATCATCCGTAATCTCGAGATTACGGATGATCTTCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007713.2-145s1c1
Sequence:CCGGCGGGAGCATGAAGGTCGACTACTCGAGTAGTCGACCTTCATGCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007713.2-873s1c1
Sequence:CCGGCCTTAGATTTCTACACGAGAACTCGAGTTCTCGTGTAGAAATCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007713.2-981s1c1
Sequence:CCGGCGAGGAGAAGTCAGTGAAGAACTCGAGTTCTTCACTGACTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007713.2-1033s1c1
Sequence:CCGGGCCACGTTTGACCATGAACATCTCGAGATGTTCATGGTCAAACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007713.4-2280s21c1
Sequence:CCGGGAAGAGTTGGAGAGCTGGACTCTCGAGAGTCCAGCTCTCCAACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007713.4-1375s21c1
Sequence:CCGGAGCTGCTCGTCTAGAAATTAACTCGAGTTAATTTCTAGACGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007713.4-2272s21c1
Sequence:CCGGCAGCACACGAAGAGTTGGAGACTCGAGTCTCCAACTCTTCGTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-1881s21c1
Sequence:CCGGTTGAGTACTACCGTGGCTTTACTCGAGTAAAGCCACGGTAGTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-1462s21c1
Sequence:CCGGGTTCAACTTCCATGGTCATATCTCGAGATATGACCATGGAAGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-1337s21c1
Sequence:CCGGGCCCTGAAGATCATCCGTAATCTCGAGATTACGGATGATCTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007713.4-933s21c1
Sequence:CCGGCCAGAAGCCATGATCGTATACCTCGAGGTATACGATCATGGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007713.4-1350s21c1
Sequence:CCGGTCCGTAATGTGGGCAAGTATCCTCGAGGATACTTGCCCACATTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007713.4-1586s21c1
Sequence:CCGGCTCTGTCATGCCCTTAGATTTCTCGAGAAATCTAAGGGCATGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks