EMAIL THIS PAGE TO A FRIEND

CLK4

CDC-like kinase 4

UniProtKB ID: Q9HAZ1
Gene ID:
Human(57396) Summary: The protein encoded by this gene belongs to the CDC2-like protein kinase (CLK) family. This protein kinase can interact with and phosphorylate the serine- and arginine-rich (SR) proteins, which are known to play an important role in the formation of spliceosomes, and thus may be involved in the regulation of alternative splicing. Studies in the Israeli sand rat Psammomys obesus suggested that the ubiquitin-like 5 (UBL5/BEACON), a highly conserved ubiquitin-like protein, may interact with and regulate the activity of this kinase. Multiple alternatively spliced transcript variants have been observed, but the full-length natures of which have not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(12750) CDC like kinase 4
Rat(287269) CDC-like kinase 4
sheep(101104233) CDC-like kinase 4
naked mole-rat(101715392) CDC-like kinase 4
domestic guinea pig(100728655) CDC-like kinase 4
chicken(416295) CDC-like kinase 4
domestic cat(101087897) CDC-like kinase 4
cow(529633) CDC-like kinase 4
Horse(100058051) CDC-like kinase 4
dog(474645) CDC-like kinase 4
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020666 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020666 Rosetta Predictions human pricing
NM_001013041 Rosetta Predictions rat pricing
NM_007714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353658 predicted 1075
2 SASI_Hs01_00012421 predicted 1549
3 SASI_Hs01_00012422 predicted 316
4 SASI_Hs01_00012423 predicted 1448
5 SASI_Hs01_00012424 predicted 1581
6 SASI_Hs01_00012425 predicted 904
7 SASI_Hs01_00012427 predicted 1360
8 SASI_Hs01_00012428 predicted 375
9 SASI_Hs01_00012429 predicted 742
10 SASI_Hs01_00012430 predicted 745
11 SASI_Hs01_00012426 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121335 predicted 740
2 SASI_Rn01_00121336 predicted 1038
3 SASI_Rn01_00121337 predicted 607
4 SASI_Rn01_00121338 predicted 836
5 SASI_Rn01_00121341 predicted 593
6 SASI_Rn01_00121342 predicted 1060
7 SASI_Rn01_00121343 predicted 1031
8 SASI_Rn02_00200634 predicted 1143
9 SASI_Rn02_00200635 predicted 916
10 SASI_Rn02_00200636 predicted 729
11 SASI_Rn01_00121339 predicted 910
12 SASI_Rn01_00121340 predicted 625
13 SASI_Rn01_00121344 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045204 predicted 1436
2 SASI_Mm02_00312280 predicted 771
3 SASI_Mm01_00045206 predicted 250
4 SASI_Mm01_00045208 predicted 894
5 SASI_Mm01_00045209 predicted 238
6 SASI_Mm01_00045210 predicted 1076
7 SASI_Mm02_00312281 predicted 1596
8 SASI_Mm01_00045211 predicted 1457
9 SASI_Mm01_00045213 predicted 1220
10 SASI_Mm02_00312282 predicted 1199
11 SASI_Mm01_00045205 predicted 546
12 SASI_Mm01_00045207 predicted 1607
13 SASI_Mm01_00045212 predicted 1408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007714
VALIDATED
CLK4 MISSION shRNA Bacterial Glycerol Stock
CDC-like kinase 4
Mouse
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007714.5-1685s21c1
Sequence:CCGGATAGCATAACTACCTTGTTAACTCGAGTTAACAAGGTAGTTATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-435s21c1
Sequence:CCGGCCCTAAGAGAAAGCGTAATAGCTCGAGCTATTACGCTTTCTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1384s21c1
Sequence:CCGGAGACGCTGCAAGCCGTTAAAGCTCGAGCTTTAACGGCTTGCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-702s21c1
Sequence:CCGGTCGTTCTGAAATCCAAGTATTCTCGAGAATACTTGGATTTCAGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-250s21c1
Sequence:CCGGGACTCGGATTGTCACTATTTACTCGAGTAAATAGTGACAATCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1090s21c1
Sequence:CCGGGACGAACATCATAGTACTTTGCTCGAGCAAAGTACTATGATGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-363s21c1
Sequence:CCGGTTACCATAGAGACGTTGAAAGCTCGAGCTTTCAACGTCTCTATGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-299s21c1
Sequence:CCGGATCGGGACCGGAGATACATTGCTCGAGCAATGTATCTCCGGTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1308s21c1
Sequence:CCGGGACAAGGAAACGCAAGTATTTCTCGAGAAATACTTGCGTTTCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007714.5-986s21c1
Sequence:GTACCGGAGTCTGACTATGTAGTCAAATCTCGAGATTTGACTACATAGTCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007714.5-1594s21c1
Sequence:GTACCGGAGACTGTGTCAGTCAACTAAACTCGAGTTTAGTTGACTGACACAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-388s21c1
Sequence:CCGGTACCGGATCCATTGCAGTAAACTCGAGTTTACTGCAATGGATCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1444s21c1
Sequence:CCGGTTTGACCTGGTTCGAAGAATGCTCGAGCATTCTTCGAACCAGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007714.2-435s1c1
Sequence:CCGGGCCCTAAGAGAAAGCGTAATACTCGAGTATTACGCTTTCTCTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-1288s1c1
Sequence:CCGGCCCAGCACATATGATCCAGAACTCGAGTTCTGGATCATATGTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-868s1c1
Sequence:CCGGGCCATTTCAAATTGATCACATCTCGAGATGTGATCAATTTGAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-307s1c1
Sequence:CCGGCCGGAGATACATTGATGAATACTCGAGTATTCATCAATGTATCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-1392s1c1
Sequence:CCGGGCAAGCCGTTAAAGGAATTTACTCGAGTAAATTCCTTTAACGGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007714
VALIDATED
CLK4 MISSION shRNA shRNA Plasmid DNA
CDC-like kinase 4
Mouse
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007714.5-1685s21c1
Sequence:CCGGATAGCATAACTACCTTGTTAACTCGAGTTAACAAGGTAGTTATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-435s21c1
Sequence:CCGGCCCTAAGAGAAAGCGTAATAGCTCGAGCTATTACGCTTTCTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1384s21c1
Sequence:CCGGAGACGCTGCAAGCCGTTAAAGCTCGAGCTTTAACGGCTTGCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-702s21c1
Sequence:CCGGTCGTTCTGAAATCCAAGTATTCTCGAGAATACTTGGATTTCAGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-250s21c1
Sequence:CCGGGACTCGGATTGTCACTATTTACTCGAGTAAATAGTGACAATCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1090s21c1
Sequence:CCGGGACGAACATCATAGTACTTTGCTCGAGCAAAGTACTATGATGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-363s21c1
Sequence:CCGGTTACCATAGAGACGTTGAAAGCTCGAGCTTTCAACGTCTCTATGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-299s21c1
Sequence:CCGGATCGGGACCGGAGATACATTGCTCGAGCAATGTATCTCCGGTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1308s21c1
Sequence:CCGGGACAAGGAAACGCAAGTATTTCTCGAGAAATACTTGCGTTTCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007714.5-986s21c1
Sequence:GTACCGGAGTCTGACTATGTAGTCAAATCTCGAGATTTGACTACATAGTCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007714.5-1594s21c1
Sequence:GTACCGGAGACTGTGTCAGTCAACTAAACTCGAGTTTAGTTGACTGACACAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-388s21c1
Sequence:CCGGTACCGGATCCATTGCAGTAAACTCGAGTTTACTGCAATGGATCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1444s21c1
Sequence:CCGGTTTGACCTGGTTCGAAGAATGCTCGAGCATTCTTCGAACCAGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007714.2-435s1c1
Sequence:CCGGGCCCTAAGAGAAAGCGTAATACTCGAGTATTACGCTTTCTCTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-1288s1c1
Sequence:CCGGCCCAGCACATATGATCCAGAACTCGAGTTCTGGATCATATGTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-868s1c1
Sequence:CCGGGCCATTTCAAATTGATCACATCTCGAGATGTGATCAATTTGAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-307s1c1
Sequence:CCGGCCGGAGATACATTGATGAATACTCGAGTATTCATCAATGTATCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-1392s1c1
Sequence:CCGGGCAAGCCGTTAAAGGAATTTACTCGAGTAAATTCCTTTAACGGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007714
VALIDATED
CLK4 MISSION shRNA Lentiviral Transduction Particles
CDC-like kinase 4
Mouse
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007714.5-1685s21c1
Sequence:CCGGATAGCATAACTACCTTGTTAACTCGAGTTAACAAGGTAGTTATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-435s21c1
Sequence:CCGGCCCTAAGAGAAAGCGTAATAGCTCGAGCTATTACGCTTTCTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1384s21c1
Sequence:CCGGAGACGCTGCAAGCCGTTAAAGCTCGAGCTTTAACGGCTTGCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-702s21c1
Sequence:CCGGTCGTTCTGAAATCCAAGTATTCTCGAGAATACTTGGATTTCAGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-250s21c1
Sequence:CCGGGACTCGGATTGTCACTATTTACTCGAGTAAATAGTGACAATCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1090s21c1
Sequence:CCGGGACGAACATCATAGTACTTTGCTCGAGCAAAGTACTATGATGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-363s21c1
Sequence:CCGGTTACCATAGAGACGTTGAAAGCTCGAGCTTTCAACGTCTCTATGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-299s21c1
Sequence:CCGGATCGGGACCGGAGATACATTGCTCGAGCAATGTATCTCCGGTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1308s21c1
Sequence:CCGGGACAAGGAAACGCAAGTATTTCTCGAGAAATACTTGCGTTTCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007714.5-986s21c1
Sequence:GTACCGGAGTCTGACTATGTAGTCAAATCTCGAGATTTGACTACATAGTCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007714.5-1594s21c1
Sequence:GTACCGGAGACTGTGTCAGTCAACTAAACTCGAGTTTAGTTGACTGACACAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-388s21c1
Sequence:CCGGTACCGGATCCATTGCAGTAAACTCGAGTTTACTGCAATGGATCCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007714.5-1444s21c1
Sequence:CCGGTTTGACCTGGTTCGAAGAATGCTCGAGCATTCTTCGAACCAGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007714.2-435s1c1
Sequence:CCGGGCCCTAAGAGAAAGCGTAATACTCGAGTATTACGCTTTCTCTTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-1288s1c1
Sequence:CCGGCCCAGCACATATGATCCAGAACTCGAGTTCTGGATCATATGTGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-868s1c1
Sequence:CCGGGCCATTTCAAATTGATCACATCTCGAGATGTGATCAATTTGAAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-307s1c1
Sequence:CCGGCCGGAGATACATTGATGAATACTCGAGTATTCATCAATGTATCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007714.2-1392s1c1
Sequence:CCGGGCAAGCCGTTAAAGGAATTTACTCGAGTAAATTCCTTTAACGGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020666
VALIDATED
CLK4 MISSION shRNA Bacterial Glycerol Stock
CDC-like kinase 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020666.2-711s21c1
Sequence:CCGGTCGTTCAGAAATCCAAGTATTCTCGAGAATACTTGGATTTCTGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020666.2-354s21c1
Sequence:CCGGAGGATATGTTCCTAGACATTACTCGAGTAATGTCTAGGAACATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020666.2-1970s21c1
Sequence:CCGGATTGTTGAACGGGTGATTATTCTCGAGAATAATCACCCGTTCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_020666.2-1136s21c1
Sequence:CCGGACAGAGCTCCCGAGGTCATTTCTCGAGAAATGACCTCGGGAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020666.2-290s21c1
Sequence:CCGGCCTTGAATGAGCGAGATTATCCTCGAGGATAATCTCGCTCATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020666.2-215s1c1
Sequence:CCGGGCACACAAGAGAACAGGCATTCTCGAGAATGCCTGTTCTCTTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196441    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020666.2-1560s1c1
Sequence:CCGGGAATCAGTGGTCTTACTATATCTCGAGATATAGTAAGACCACTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020666.2-712s1c1
Sequence:CCGGCGTTCAGAAATCCAAGTATTACTCGAGTAATACTTGGATTTCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020666.x-219s1c1
Sequence:CCGGTGACGAATACAGGAATGACTACTCGAGTAGTCATTCCTGTATTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020666.x-1156s1c1
Sequence:CCGGCTGGCAATGATGGAACGAATACTCGAGTATTCGTTCCATCATTGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020666.x-1413s1c1
Sequence:CCGGGCATCCTTTCTTTGACTTATTCTCGAGAATAAGTCAAAGAAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020666.x-1698s1c1
Sequence:CCGGGTGTCCAGTGATAAATGTGATCTCGAGATCACATTTATCACTGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020666.x-661s1c1
Sequence:CCGGCGATGTGTCCAGATGCTAGAACTCGAGTTCTAGCATCTGGACACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020666
VALIDATED
CLK4 MISSION shRNA shRNA Plasmid DNA
CDC-like kinase 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020666.2-711s21c1
Sequence:CCGGTCGTTCAGAAATCCAAGTATTCTCGAGAATACTTGGATTTCTGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020666.2-354s21c1
Sequence:CCGGAGGATATGTTCCTAGACATTACTCGAGTAATGTCTAGGAACATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020666.2-1970s21c1
Sequence:CCGGATTGTTGAACGGGTGATTATTCTCGAGAATAATCACCCGTTCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_020666.2-1136s21c1
Sequence:CCGGACAGAGCTCCCGAGGTCATTTCTCGAGAAATGACCTCGGGAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020666.2-290s21c1
Sequence:CCGGCCTTGAATGAGCGAGATTATCCTCGAGGATAATCTCGCTCATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020666.2-215s1c1
Sequence:CCGGGCACACAAGAGAACAGGCATTCTCGAGAATGCCTGTTCTCTTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196441    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020666.2-1560s1c1
Sequence:CCGGGAATCAGTGGTCTTACTATATCTCGAGATATAGTAAGACCACTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020666.2-712s1c1
Sequence:CCGGCGTTCAGAAATCCAAGTATTACTCGAGTAATACTTGGATTTCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020666.x-219s1c1
Sequence:CCGGTGACGAATACAGGAATGACTACTCGAGTAGTCATTCCTGTATTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020666.x-1156s1c1
Sequence:CCGGCTGGCAATGATGGAACGAATACTCGAGTATTCGTTCCATCATTGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020666.x-1413s1c1
Sequence:CCGGGCATCCTTTCTTTGACTTATTCTCGAGAATAAGTCAAAGAAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020666.x-1698s1c1
Sequence:CCGGGTGTCCAGTGATAAATGTGATCTCGAGATCACATTTATCACTGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020666.x-661s1c1
Sequence:CCGGCGATGTGTCCAGATGCTAGAACTCGAGTTCTAGCATCTGGACACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020666
VALIDATED
CLK4 MISSION shRNA Lentiviral Transduction Particles
CDC-like kinase 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020666.2-711s21c1
Sequence:CCGGTCGTTCAGAAATCCAAGTATTCTCGAGAATACTTGGATTTCTGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020666.2-354s21c1
Sequence:CCGGAGGATATGTTCCTAGACATTACTCGAGTAATGTCTAGGAACATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020666.2-1970s21c1
Sequence:CCGGATTGTTGAACGGGTGATTATTCTCGAGAATAATCACCCGTTCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_020666.2-1136s21c1
Sequence:CCGGACAGAGCTCCCGAGGTCATTTCTCGAGAAATGACCTCGGGAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020666.2-290s21c1
Sequence:CCGGCCTTGAATGAGCGAGATTATCCTCGAGGATAATCTCGCTCATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020666.2-215s1c1
Sequence:CCGGGCACACAAGAGAACAGGCATTCTCGAGAATGCCTGTTCTCTTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196441    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020666.2-1560s1c1
Sequence:CCGGGAATCAGTGGTCTTACTATATCTCGAGATATAGTAAGACCACTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020666.2-712s1c1
Sequence:CCGGCGTTCAGAAATCCAAGTATTACTCGAGTAATACTTGGATTTCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020666.x-219s1c1
Sequence:CCGGTGACGAATACAGGAATGACTACTCGAGTAGTCATTCCTGTATTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020666.x-1156s1c1
Sequence:CCGGCTGGCAATGATGGAACGAATACTCGAGTATTCGTTCCATCATTGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020666.x-1413s1c1
Sequence:CCGGGCATCCTTTCTTTGACTTATTCTCGAGAATAAGTCAAAGAAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001350    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020666.x-1698s1c1
Sequence:CCGGGTGTCCAGTGATAAATGTGATCTCGAGATCACATTTATCACTGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020666.x-661s1c1
Sequence:CCGGCGATGTGTCCAGATGCTAGAACTCGAGTTCTAGCATCTGGACACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks