EMAIL THIS PAGE TO A FRIEND

CLLU1

chronic lymphocytic leukemia up-regulated 1

114 Gene Product Result for
Species: Human CLLU1(574028)
UniProtKB ID: Q5K131
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025233 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025233 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140027 predicted 958
2 SASI_Hs01_00140028 predicted 955
3 SASI_Hs01_00140029 predicted 1093
4 SASI_Hs01_00140031 predicted 1104
5 SASI_Hs02_00307423 predicted 837
6 SASI_Hs01_00140033 predicted 943
7 SASI_Hs01_00140034 predicted 1021
8 SASI_Hs01_00140035 predicted 1202
9 SASI_Hs01_00140036 predicted 1174
10 SASI_Hs02_00307424 predicted 1186
11 SASI_Hs01_00140030 predicted 1195
12 SASI_Hs01_00140032 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025233
CLLU1 MISSION shRNA Bacterial Glycerol Stock
chronic lymphocytic leukemia up-regulated 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025233.1-2196s1c1
Sequence:CCGGCCATTCATTTATCAGAGCAAACTCGAGTTTGCTCTGATAAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025233.1-962s1c1
Sequence:CCGGGTGTGAGCAATATGTCACTTTCTCGAGAAAGTGACATATTGCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025233.1-787s1c1
Sequence:CCGGGCCTTTGTGCTATTATCTGTTCTCGAGAACAGATAATAGCACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025233.1-887s1c1
Sequence:CCGGCAACAGAATACGATTTAGCAACTCGAGTTGCTAAATCGTATTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025233
CLLU1 MISSION shRNA shRNA Plasmid DNA
chronic lymphocytic leukemia up-regulated 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025233.1-2196s1c1
Sequence:CCGGCCATTCATTTATCAGAGCAAACTCGAGTTTGCTCTGATAAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025233.1-962s1c1
Sequence:CCGGGTGTGAGCAATATGTCACTTTCTCGAGAAAGTGACATATTGCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025233.1-787s1c1
Sequence:CCGGGCCTTTGTGCTATTATCTGTTCTCGAGAACAGATAATAGCACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025233.1-887s1c1
Sequence:CCGGCAACAGAATACGATTTAGCAACTCGAGTTGCTAAATCGTATTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025233
CLLU1 MISSION shRNA Lentiviral Transduction Particles
chronic lymphocytic leukemia up-regulated 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183742    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001025233.1-2196s1c1
Sequence:CCGGCCATTCATTTATCAGAGCAAACTCGAGTTTGCTCTGATAAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025233.1-962s1c1
Sequence:CCGGGTGTGAGCAATATGTCACTTTCTCGAGAAAGTGACATATTGCTCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025233.1-787s1c1
Sequence:CCGGGCCTTTGTGCTATTATCTGTTCTCGAGAACAGATAATAGCACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025233.1-887s1c1
Sequence:CCGGCAACAGAATACGATTTAGCAACTCGAGTTGCTAAATCGTATTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks