EMAIL THIS PAGE TO A FRIEND

CLLU1OS

chronic lymphocytic leukemia up-regulated 1 opposite strand

14 Gene Product Result for
Species: Human CLLU1OS(574016)
UniProtKB ID: Q5K130
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025232 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025232 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116925 predicted 192
2 SASI_Hs01_00116926 predicted 349
3 SASI_Hs01_00116927 predicted 333
4 SASI_Hs01_00116928 predicted 257
5 SASI_Hs01_00116929 predicted 252
6 SASI_Hs01_00116930 predicted 343
7 SASI_Hs01_00116931 predicted 313
8 SASI_Hs01_00116932 predicted 326
9 SASI_Hs01_00116933 predicted 334
10 SASI_Hs01_00116934 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025232
CLLU1OS MISSION shRNA Bacterial Glycerol Stock
chronic lymphocytic leukemia up-regulated 1 opposite strand
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025232.1-33s1c1
Sequence:CCGGGAATGCCTTAAGACTGCCACTCTCGAGAGTGGCAGTCTTAAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025232.1-226s1c1
Sequence:CCGGGCAAAGGAAATGTGACAAGGACTCGAGTCCTTGTCACATTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-141s21c1
Sequence:CCGGGAAGTGGCCTTGCTAACAAGTCTCGAGACTTGTTAGCAAGGCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-163s21c1
Sequence:CCGGTACCTCCAAACTATGAGATTTCTCGAGAAATCTCATAGTTTGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-63s21c1
Sequence:CCGGCAGACAGTGCAGCCTAGTATCCTCGAGGATACTAGGCTGCACTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025232.1-371s21c1
Sequence:CCGGTCTCCTGGAGTCGGTGGTTTACTCGAGTAAACCACCGACTCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-38s21c1
Sequence:CCGGCCTTAAGACTGCCACTGATTCCTCGAGGAATCAGTGGCAGTCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025232
CLLU1OS MISSION shRNA shRNA Plasmid DNA
chronic lymphocytic leukemia up-regulated 1 opposite strand
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025232.1-33s1c1
Sequence:CCGGGAATGCCTTAAGACTGCCACTCTCGAGAGTGGCAGTCTTAAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025232.1-226s1c1
Sequence:CCGGGCAAAGGAAATGTGACAAGGACTCGAGTCCTTGTCACATTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-141s21c1
Sequence:CCGGGAAGTGGCCTTGCTAACAAGTCTCGAGACTTGTTAGCAAGGCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-163s21c1
Sequence:CCGGTACCTCCAAACTATGAGATTTCTCGAGAAATCTCATAGTTTGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-63s21c1
Sequence:CCGGCAGACAGTGCAGCCTAGTATCCTCGAGGATACTAGGCTGCACTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025232.1-371s21c1
Sequence:CCGGTCTCCTGGAGTCGGTGGTTTACTCGAGTAAACCACCGACTCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-38s21c1
Sequence:CCGGCCTTAAGACTGCCACTGATTCCTCGAGGAATCAGTGGCAGTCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025232
CLLU1OS MISSION shRNA Lentiviral Transduction Particles
chronic lymphocytic leukemia up-regulated 1 opposite strand
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025232.1-33s1c1
Sequence:CCGGGAATGCCTTAAGACTGCCACTCTCGAGAGTGGCAGTCTTAAGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025232.1-226s1c1
Sequence:CCGGGCAAAGGAAATGTGACAAGGACTCGAGTCCTTGTCACATTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-141s21c1
Sequence:CCGGGAAGTGGCCTTGCTAACAAGTCTCGAGACTTGTTAGCAAGGCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-163s21c1
Sequence:CCGGTACCTCCAAACTATGAGATTTCTCGAGAAATCTCATAGTTTGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-63s21c1
Sequence:CCGGCAGACAGTGCAGCCTAGTATCCTCGAGGATACTAGGCTGCACTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025232.1-371s21c1
Sequence:CCGGTCTCCTGGAGTCGGTGGTTTACTCGAGTAAACCACCGACTCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025232.1-38s21c1
Sequence:CCGGCCTTAAGACTGCCACTGATTCCTCGAGGAATCAGTGGCAGTCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks