EMAIL THIS PAGE TO A FRIEND

CLMN

calmin (calponin-like, transmembrane)

58 Gene Product Result for
Gene ID:
Mouse(94040) calmin
Rat(299285) calmin
chicken(423438) calmin (calponin-like, transmembrane)
cow(505010) calmin (calponin-like, transmembrane)
Horse(100065725) calmin (calponin-like, transmembrane)
domestic cat(101089701) calmin (calponin-like, transmembrane)
dog(480427) calmin (calponin-like, transmembrane)
domestic guinea pig(100723506) calmin (calponin-like, transmembrane)
naked mole-rat(101721644) calmin (calponin-like, transmembrane)
sheep(101115830) calmin (calponin-like, transmembrane)
Domestic Rabbit(100358224) calmin (calponin-like, transmembrane)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV53773 Anti-CLMN (AB1) antibody produced in rabbit affinity isolated antibody bovine, rat, horse, human, mouse, rabbit, canine, guinea pig
western blot pricing
AV53774 Anti-CLMN (AB2) antibody produced in rabbit affinity isolated antibody human, bovine, mouse, canine
western blot pricing
HPA012634 Anti-CLMN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024734 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035151 MISSION® esiRNA esiRNA human CLMN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024734 Rosetta Predictions human pricing
NM_001106755 Rosetta Predictions rat pricing
NM_001040682 Rosetta Predictions mouse pricing
NM_053155 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079280 predicted 907
2 SASI_Hs01_00079281 predicted 862
3 SASI_Hs01_00079282 predicted 1718
4 SASI_Hs01_00079283 predicted 2882
5 SASI_Hs02_00357208 predicted 607
6 SASI_Hs01_00079285 predicted 1339
7 SASI_Hs01_00079286 predicted 1586
8 SASI_Hs01_00079287 predicted 697
9 SASI_Hs02_00357209 predicted 1666
10 SASI_Hs01_00079288 predicted 343
11 SASI_Hs01_00079284 predicted 1249
12 SASI_Hs01_00079289 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222078 predicted 2880
2 SASI_Rn02_00222079 predicted 2761
3 SASI_Rn02_00222080 predicted 1463
4 SASI_Rn02_00222081 predicted 1788
5 SASI_Rn02_00222082 predicted 3224
6 SASI_Rn02_00222083 predicted 320
7 SASI_Rn02_00222084 predicted 1819
8 SASI_Rn02_00222085 predicted 3214
9 SASI_Rn02_00222086 predicted 2110
10 SASI_Rn02_00222087 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290334 predicted 964
2 SASI_Mm01_00111007 predicted 1254
3 SASI_Mm01_00111008 predicted 2781
4 SASI_Mm01_00111009 predicted 347
5 SASI_Mm01_00111010 predicted 317
6 SASI_Mm01_00111011 predicted 1486
7 SASI_Mm01_00111013 predicted 507
8 SASI_Mm01_00111014 predicted 2330
9 SASI_Mm01_00111015 predicted 2131
10 SASI_Mm01_00111016 predicted 1225
11 SASI_Mm01_00111012 predicted 2270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337678 predicted 958
2 SASI_Mm01_00114084 predicted 1254
3 SASI_Mm01_00114085 predicted 2777
4 SASI_Mm01_00114086 predicted 353
5 SASI_Mm01_00114087 predicted 322
6 SASI_Mm01_00114088 predicted 1488
7 SASI_Mm01_00114090 predicted 503
8 SASI_Mm01_00114091 predicted 2330
9 SASI_Mm01_00114092 predicted 2132
10 SASI_Mm01_00114093 predicted 1229
11 SASI_Mm01_00114089 predicted 2272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053155
CLMN MISSION shRNA Bacterial Glycerol Stock
calmin (calponin-like, transmembrane)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-463s21c1
Sequence:CCGGGCATCGATGCAGCGGAAATAGCTCGAGCTATTTCCGCTGCATCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-233s21c1
Sequence:CCGGGACTTTCACACGATGGATAAACTCGAGTTTATCCATCGTGTGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-3169s21c1
Sequence:CCGGACGACTCTCTGACGCAGTTTGCTCGAGCAAACTGCGTCAGAGAGTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-356s21c1
Sequence:CCGGGCGAAATCTGCTGCATGAATACTCGAGTATTCATGCAGCAGATTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-2263s1c1
Sequence:CCGGCGAAGAAGGTTTGGATTTCAACTCGAGTTGAAATCCAAACCTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-502s1c1
Sequence:CCGGCGGGCTGATATGGAACATCATCTCGAGATGATGTTCCATATCAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053155.1-2995s1c1
Sequence:CCGGGCGACACACTAATAGGTCTTTCTCGAGAAAGACCTATTAGTGTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-395s1c1
Sequence:CCGGCGGTTGAACAACATAGCGAAACTCGAGTTTCGCTATGTTGTTCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-2788s1c1
Sequence:CCGGCCACGTAGAAAGCTCATTATTCTCGAGAATAATGAGCTTTCTACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053155
CLMN MISSION shRNA shRNA Plasmid DNA
calmin (calponin-like, transmembrane)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-463s21c1
Sequence:CCGGGCATCGATGCAGCGGAAATAGCTCGAGCTATTTCCGCTGCATCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-233s21c1
Sequence:CCGGGACTTTCACACGATGGATAAACTCGAGTTTATCCATCGTGTGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-3169s21c1
Sequence:CCGGACGACTCTCTGACGCAGTTTGCTCGAGCAAACTGCGTCAGAGAGTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-356s21c1
Sequence:CCGGGCGAAATCTGCTGCATGAATACTCGAGTATTCATGCAGCAGATTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-2263s1c1
Sequence:CCGGCGAAGAAGGTTTGGATTTCAACTCGAGTTGAAATCCAAACCTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-502s1c1
Sequence:CCGGCGGGCTGATATGGAACATCATCTCGAGATGATGTTCCATATCAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053155.1-2995s1c1
Sequence:CCGGGCGACACACTAATAGGTCTTTCTCGAGAAAGACCTATTAGTGTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-395s1c1
Sequence:CCGGCGGTTGAACAACATAGCGAAACTCGAGTTTCGCTATGTTGTTCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-2788s1c1
Sequence:CCGGCCACGTAGAAAGCTCATTATTCTCGAGAATAATGAGCTTTCTACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053155
CLMN MISSION shRNA Lentiviral Transduction Particles
calmin (calponin-like, transmembrane)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-463s21c1
Sequence:CCGGGCATCGATGCAGCGGAAATAGCTCGAGCTATTTCCGCTGCATCGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-233s21c1
Sequence:CCGGGACTTTCACACGATGGATAAACTCGAGTTTATCCATCGTGTGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-3169s21c1
Sequence:CCGGACGACTCTCTGACGCAGTTTGCTCGAGCAAACTGCGTCAGAGAGTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053155.2-356s21c1
Sequence:CCGGGCGAAATCTGCTGCATGAATACTCGAGTATTCATGCAGCAGATTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-2263s1c1
Sequence:CCGGCGAAGAAGGTTTGGATTTCAACTCGAGTTGAAATCCAAACCTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-502s1c1
Sequence:CCGGCGGGCTGATATGGAACATCATCTCGAGATGATGTTCCATATCAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053155.1-2995s1c1
Sequence:CCGGGCGACACACTAATAGGTCTTTCTCGAGAAAGACCTATTAGTGTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-395s1c1
Sequence:CCGGCGGTTGAACAACATAGCGAAACTCGAGTTTCGCTATGTTGTTCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053155.1-2788s1c1
Sequence:CCGGCCACGTAGAAAGCTCATTATTCTCGAGAATAATGAGCTTTCTACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024734
VALIDATED
CLMN MISSION shRNA Bacterial Glycerol Stock
calmin (calponin-like, transmembrane)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-224s21c1
Sequence:CCGGGACCTTTACACGATGGATAAACTCGAGTTTATCCATCGTGTAAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-2931s21c1
Sequence:CCGGGACAGAAGAAACCGAATATTACTCGAGTAATATTCGGTTTCTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-3410s21c1
Sequence:CCGGGAGCATTGTTAGTGATCATTACTCGAGTAATGATCACTAACAATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-1740s21c1
Sequence:CCGGGTTAACCTGATGACTGTAGAACTCGAGTTCTACAGTCATCAGGTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-2732s21c1
Sequence:CCGGCCACGTAGAAAGTTCACTATTCTCGAGAATAGTGAACTTTCTACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024734.2-1204s1c1
Sequence:CCGGCGAGTTCATGCACCAGATTATCTCGAGATAATCTGGTGCATGAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024734.2-181s1c1
Sequence:CCGGGACCTTTACACGATGGATAAACTCGAGTTTATCCATCGTGTAAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024734.2-2689s1c1
Sequence:CCGGCCACGTAGAAAGTTCACTATTCTCGAGAATAGTGAACTTTCTACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024734.2-251s1c1
Sequence:CCGGGTCGATATACAAGATGGCAAACTCGAGTTTGCCATCTTGTATATCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024734.2-1697s1c1
Sequence:CCGGGTTAACCTGATGACTGTAGAACTCGAGTTCTACAGTCATCAGGTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024734
VALIDATED
CLMN MISSION shRNA shRNA Plasmid DNA
calmin (calponin-like, transmembrane)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-224s21c1
Sequence:CCGGGACCTTTACACGATGGATAAACTCGAGTTTATCCATCGTGTAAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-2931s21c1
Sequence:CCGGGACAGAAGAAACCGAATATTACTCGAGTAATATTCGGTTTCTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-3410s21c1
Sequence:CCGGGAGCATTGTTAGTGATCATTACTCGAGTAATGATCACTAACAATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-1740s21c1
Sequence:CCGGGTTAACCTGATGACTGTAGAACTCGAGTTCTACAGTCATCAGGTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-2732s21c1
Sequence:CCGGCCACGTAGAAAGTTCACTATTCTCGAGAATAGTGAACTTTCTACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024734.2-1204s1c1
Sequence:CCGGCGAGTTCATGCACCAGATTATCTCGAGATAATCTGGTGCATGAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024734.2-181s1c1
Sequence:CCGGGACCTTTACACGATGGATAAACTCGAGTTTATCCATCGTGTAAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024734.2-2689s1c1
Sequence:CCGGCCACGTAGAAAGTTCACTATTCTCGAGAATAGTGAACTTTCTACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024734.2-251s1c1
Sequence:CCGGGTCGATATACAAGATGGCAAACTCGAGTTTGCCATCTTGTATATCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024734.2-1697s1c1
Sequence:CCGGGTTAACCTGATGACTGTAGAACTCGAGTTCTACAGTCATCAGGTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024734
VALIDATED
CLMN MISSION shRNA Lentiviral Transduction Particles
calmin (calponin-like, transmembrane)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-224s21c1
Sequence:CCGGGACCTTTACACGATGGATAAACTCGAGTTTATCCATCGTGTAAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-2931s21c1
Sequence:CCGGGACAGAAGAAACCGAATATTACTCGAGTAATATTCGGTTTCTTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-3410s21c1
Sequence:CCGGGAGCATTGTTAGTGATCATTACTCGAGTAATGATCACTAACAATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-1740s21c1
Sequence:CCGGGTTAACCTGATGACTGTAGAACTCGAGTTCTACAGTCATCAGGTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024734.3-2732s21c1
Sequence:CCGGCCACGTAGAAAGTTCACTATTCTCGAGAATAGTGAACTTTCTACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024734.2-1204s1c1
Sequence:CCGGCGAGTTCATGCACCAGATTATCTCGAGATAATCTGGTGCATGAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024734.2-181s1c1
Sequence:CCGGGACCTTTACACGATGGATAAACTCGAGTTTATCCATCGTGTAAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024734.2-2689s1c1
Sequence:CCGGCCACGTAGAAAGTTCACTATTCTCGAGAATAGTGAACTTTCTACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024734.2-251s1c1
Sequence:CCGGGTCGATATACAAGATGGCAAACTCGAGTTTGCCATCTTGTATATCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024734.2-1697s1c1
Sequence:CCGGGTTAACCTGATGACTGTAGAACTCGAGTTCTACAGTCATCAGGTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)