EMAIL THIS PAGE TO A FRIEND

CLMP

CXADR-like membrane protein

127 Gene Product Result for
Synonyms: ACAM ASAM CSBM CSBS
UniProtKB ID: Q9H6B4
Gene ID:
Human(79827) Summary: The CTX (see VSIG2, MIM 606011) family of proteins, including ASAM, are type I transmembrane proteins within the Ig superfamily that localize to junctional complexes between endothelial and epithelial cells and may play a role in cell-cell adhesion (Raschperger et al., 2004 [PubMed 14573622]
Mouse(71566) CXADR-like membrane protein
Rat(286939) CXADR-like membrane protein
sheep(780518) CXADR-like membrane protein
naked mole-rat(101707955) CXADR-like membrane protein
domestic guinea pig(100713297) CXADR-like membrane protein
chicken(419747) CXADR-like membrane protein
cow(516565) CXADR-like membrane protein
Horse(100071682) CXADR-like membrane protein
domestic cat(101092046) CXADR-like membrane protein
dog(489353) CXADR-like membrane protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024769 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024769 Rosetta Predictions human pricing
NM_173154 Rosetta Predictions rat pricing
NM_133733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061781 predicted 1158
2 SASI_Hs02_00357276 predicted 749
3 SASI_Hs01_00061782 predicted 1394
4 SASI_Hs01_00061784 predicted 893
5 SASI_Hs01_00061785 predicted 1562
6 SASI_Hs02_00357277 predicted 1404
7 SASI_Hs01_00061786 predicted 987
8 SASI_Hs02_00357278 predicted 1466
9 SASI_Hs01_00061788 predicted 517
10 SASI_Hs01_00061789 predicted 802
11 SASI_Hs01_00061783 predicted 1527
12 SASI_Hs01_00061787 predicted 793
13 SASI_Hs01_00061790 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063245 predicted 484
2 SASI_Rn01_00063246 predicted 632
3 SASI_Rn01_00063247 predicted 525
4 SASI_Rn01_00063248 predicted 409
5 SASI_Rn02_00269348 predicted 253
6 SASI_Rn01_00063250 predicted 1189
7 SASI_Rn01_00063251 predicted 574
8 SASI_Rn01_00063252 predicted 1251
9 SASI_Rn01_00063253 predicted 881
10 SASI_Rn01_00063254 predicted 1297
11 SASI_Rn01_00063249 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091715 predicted 906
2 SASI_Mm01_00091716 predicted 1165
3 SASI_Mm01_00091718 predicted 685
4 SASI_Mm01_00091719 predicted 387
5 SASI_Mm01_00091720 predicted 527
6 SASI_Mm02_00338716 predicted 520
7 SASI_Mm01_00091721 predicted 799
8 SASI_Mm01_00091722 predicted 1153
9 SASI_Mm01_00091723 predicted 1113
10 SASI_Mm01_00091724 predicted 839
11 SASI_Mm01_00091717 predicted 1146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024769
VALIDATED
CLMP MISSION shRNA Bacterial Glycerol Stock
CXADR-like membrane protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024769.2-643s1c1
Sequence:CCGGCCTTGCAGATTGAACCTCTGACTCGAGTCAGAGGTTCAATCTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024769.2-1611s1c1
Sequence:CCGGGAACAGATTCAGATGAGCATTCTCGAGAATGCTCATCTGAATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024769.2-1155s1c1
Sequence:CCGGGAAGAAGAGAGACCTAATGAACTCGAGTTCATTAGGTCTCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024769.2-683s1c1
Sequence:CCGGGTACACCTGTAAGGTTAAGAACTCGAGTTCTTAACCTTACAGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024769.2-1122s1c1
Sequence:CCGGCTAATCCGAAGGAAAGACAAACTCGAGTTTGTCTTTCCTTCGGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024769.2-559s1c1
Sequence:CCGGCCAGTCGTCATGTCTACAATACTCGAGTATTGTAGACATGACGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024769.2-515s1c1
Sequence:CCGGGCTCACCGATAATGAAGGGAACTCGAGTTCCCTTCATTATCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024769.2-790s1c1
Sequence:CCGGCAGAAGGAAGTGACCTGACTTCTCGAGAAGTCAGGTCACTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024769
VALIDATED
CLMP MISSION shRNA shRNA Plasmid DNA
CXADR-like membrane protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024769.2-643s1c1
Sequence:CCGGCCTTGCAGATTGAACCTCTGACTCGAGTCAGAGGTTCAATCTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024769.2-1611s1c1
Sequence:CCGGGAACAGATTCAGATGAGCATTCTCGAGAATGCTCATCTGAATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024769.2-1155s1c1
Sequence:CCGGGAAGAAGAGAGACCTAATGAACTCGAGTTCATTAGGTCTCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024769.2-683s1c1
Sequence:CCGGGTACACCTGTAAGGTTAAGAACTCGAGTTCTTAACCTTACAGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024769.2-1122s1c1
Sequence:CCGGCTAATCCGAAGGAAAGACAAACTCGAGTTTGTCTTTCCTTCGGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024769.2-559s1c1
Sequence:CCGGCCAGTCGTCATGTCTACAATACTCGAGTATTGTAGACATGACGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024769.2-515s1c1
Sequence:CCGGGCTCACCGATAATGAAGGGAACTCGAGTTCCCTTCATTATCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024769.2-790s1c1
Sequence:CCGGCAGAAGGAAGTGACCTGACTTCTCGAGAAGTCAGGTCACTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024769
VALIDATED
CLMP MISSION shRNA Lentiviral Transduction Particles
CXADR-like membrane protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024769.2-643s1c1
Sequence:CCGGCCTTGCAGATTGAACCTCTGACTCGAGTCAGAGGTTCAATCTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024769.2-1611s1c1
Sequence:CCGGGAACAGATTCAGATGAGCATTCTCGAGAATGCTCATCTGAATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024769.2-1155s1c1
Sequence:CCGGGAAGAAGAGAGACCTAATGAACTCGAGTTCATTAGGTCTCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024769.2-683s1c1
Sequence:CCGGGTACACCTGTAAGGTTAAGAACTCGAGTTCTTAACCTTACAGGTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024769.2-1122s1c1
Sequence:CCGGCTAATCCGAAGGAAAGACAAACTCGAGTTTGTCTTTCCTTCGGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024769.2-559s1c1
Sequence:CCGGCCAGTCGTCATGTCTACAATACTCGAGTATTGTAGACATGACGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024769.2-515s1c1
Sequence:CCGGGCTCACCGATAATGAAGGGAACTCGAGTTCCCTTCATTATCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024769.2-790s1c1
Sequence:CCGGCAGAAGGAAGTGACCTGACTTCTCGAGAAGTCAGGTCACTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133733
VALIDATED
CLMP MISSION shRNA Bacterial Glycerol Stock
CXADR-like membrane protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133733.2-905s1c1
Sequence:CCGGCTGCCACCCAAATCCAGAATTCTCGAGAATTCTGGATTTGGGTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133733.2-1162s1c1
Sequence:CCGGCGAGGAAGAAGACAGACCTAACTCGAGTTAGGTCTGTCTTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133733.2-908s1c1
Sequence:CCGGCCACCCAAATCCAGAATTGATCTCGAGATCAATTCTGGATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133733.2-570s1c1
Sequence:CCGGCCAGCCGTCATGTCTACAATACTCGAGTATTGTAGACATGACGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133733.2-2321s1c1
Sequence:CCGGGCTGGATGTTTCTAGGAGAAACTCGAGTTTCTCCTAGAAACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133733.4-516s21c1
Sequence:CCGGGAATGGCTGCTCACCGATAATCTCGAGATTATCGGTGAGCAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133733.4-1117s21c1
Sequence:CCGGTCCTGATATGGCTGCTAATACCTCGAGGTATTAGCAGCCATATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133733.4-2319s21c1
Sequence:CCGGGCTGGATGTTTCTAGGAGAAACTCGAGTTTCTCCTAGAAACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133733.4-906s21c1
Sequence:CCGGCCACCCAAATCCAGAATTGATCTCGAGATCAATTCTGGATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133733.4-570s21c1
Sequence:CCGGAGCCGTCATGTCTACAATAACCTCGAGGTTATTGTAGACATGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133733
VALIDATED
CLMP MISSION shRNA shRNA Plasmid DNA
CXADR-like membrane protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133733.2-905s1c1
Sequence:CCGGCTGCCACCCAAATCCAGAATTCTCGAGAATTCTGGATTTGGGTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133733.2-1162s1c1
Sequence:CCGGCGAGGAAGAAGACAGACCTAACTCGAGTTAGGTCTGTCTTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133733.2-908s1c1
Sequence:CCGGCCACCCAAATCCAGAATTGATCTCGAGATCAATTCTGGATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133733.2-570s1c1
Sequence:CCGGCCAGCCGTCATGTCTACAATACTCGAGTATTGTAGACATGACGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133733.2-2321s1c1
Sequence:CCGGGCTGGATGTTTCTAGGAGAAACTCGAGTTTCTCCTAGAAACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133733.4-516s21c1
Sequence:CCGGGAATGGCTGCTCACCGATAATCTCGAGATTATCGGTGAGCAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133733.4-1117s21c1
Sequence:CCGGTCCTGATATGGCTGCTAATACCTCGAGGTATTAGCAGCCATATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133733.4-2319s21c1
Sequence:CCGGGCTGGATGTTTCTAGGAGAAACTCGAGTTTCTCCTAGAAACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133733.4-906s21c1
Sequence:CCGGCCACCCAAATCCAGAATTGATCTCGAGATCAATTCTGGATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133733.4-570s21c1
Sequence:CCGGAGCCGTCATGTCTACAATAACCTCGAGGTTATTGTAGACATGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133733
VALIDATED
CLMP MISSION shRNA Lentiviral Transduction Particles
CXADR-like membrane protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133733.2-905s1c1
Sequence:CCGGCTGCCACCCAAATCCAGAATTCTCGAGAATTCTGGATTTGGGTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133733.2-1162s1c1
Sequence:CCGGCGAGGAAGAAGACAGACCTAACTCGAGTTAGGTCTGTCTTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133733.2-908s1c1
Sequence:CCGGCCACCCAAATCCAGAATTGATCTCGAGATCAATTCTGGATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133733.2-570s1c1
Sequence:CCGGCCAGCCGTCATGTCTACAATACTCGAGTATTGTAGACATGACGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125329    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133733.2-2321s1c1
Sequence:CCGGGCTGGATGTTTCTAGGAGAAACTCGAGTTTCTCCTAGAAACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133733.4-516s21c1
Sequence:CCGGGAATGGCTGCTCACCGATAATCTCGAGATTATCGGTGAGCAGCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133733.4-1117s21c1
Sequence:CCGGTCCTGATATGGCTGCTAATACCTCGAGGTATTAGCAGCCATATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133733.4-2319s21c1
Sequence:CCGGGCTGGATGTTTCTAGGAGAAACTCGAGTTTCTCCTAGAAACATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133733.4-906s21c1
Sequence:CCGGCCACCCAAATCCAGAATTGATCTCGAGATCAATTCTGGATTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133733.4-570s21c1
Sequence:CCGGAGCCGTCATGTCTACAATAACCTCGAGGTTATTGTAGACATGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks