EMAIL THIS PAGE TO A FRIEND

CLN3

ceroid-lipofuscinosis, neuronal 3

65 Gene Product Result for
Synonyms: BTS JNCL
Gene ID:
Human(1201) Summary: This gene encodes a protein that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis (CLN) genes, cause neurodegenerative diseases commonly known as Batten disease or collectively known as neuronal ceroid lipofuscinoses (NCLs). Many alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12752) ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease)
Rat(293485) ceroid-lipofuscinosis, neuronal 3
Zebrafish(492340) ceroid-lipofuscinosis, neuronal 3
dog(479794) ceroid-lipofuscinosis, neuronal 3
domestic cat(101089821) ceroid-lipofuscinosis, neuronal 3
cow(504799) ceroid-lipofuscinosis, neuronal 3
fruit fly(39981) CG5582 gene product from transcript CG5582-RA
domestic guinea pig(100727617) ceroid-lipofuscinosis, neuronal 3
naked mole-rat(101722930) ceroid-lipofuscinosis, neuronal 3
sheep(101112942) ceroid-lipofuscinosis, neuronal 3
Domestic Rabbit(100009244) ceroid-lipofuscinosis, neuronal 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000086 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000086 Rosetta Predictions human pricing
NM_001042432 Rosetta Predictions human pricing
NM_001006971 Rosetta Predictions rat pricing
NM_009907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301835 predicted 569
2 SASI_Hs01_00055242 predicted 956
3 SASI_Hs01_00055243 predicted 854
4 SASI_Hs02_00301836 predicted 783
5 SASI_Hs01_00055244 predicted 1093
6 SASI_Hs02_00301837 predicted 636
7 SASI_Hs01_00055248 predicted 1594
8 SASI_Hs01_00055249 predicted 1520
9 SASI_Hs02_00301838 predicted 697
10 SASI_Hs02_00301839 predicted 568
11 SASI_Hs01_00055245 predicted 1256
12 SASI_Hs01_00055246 predicted 947
13 SASI_Hs01_00055247 predicted 1001
14 SASI_Hs01_00055250 predicted 953
15 SASI_Hs01_00055251 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309748 predicted 607
2 SASI_Hs02_00309749 predicted 990
3 SASI_Hs02_00309750 predicted 887
4 SASI_Hs02_00309751 predicted 813
5 SASI_Hs02_00309752 predicted 1129
6 SASI_Hs02_00309753 predicted 680
7 SASI_Hs02_00309754 predicted 1632
8 SASI_Hs02_00309755 predicted 1556
9 SASI_Hs02_00309756 predicted 732
10 SASI_Hs02_00309757 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041437 predicted 933
2 SASI_Rn01_00041439 predicted 415
3 SASI_Rn01_00041440 predicted 1025
4 SASI_Rn01_00041441 predicted 1282
5 SASI_Rn01_00041442 predicted 690
6 SASI_Rn01_00041443 predicted 1370
7 SASI_Rn01_00041444 predicted 1323
8 SASI_Rn01_00041445 predicted 563
9 SASI_Rn02_00198528 predicted 417
10 SASI_Rn01_00041446 predicted 1110
11 SASI_Rn01_00041438 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052943 predicted 1047
2 SASI_Mm02_00317424 predicted 947
3 SASI_Mm01_00052944 predicted 1520
4 SASI_Mm01_00052945 predicted 1341
5 SASI_Mm01_00052946 predicted 1129
6 SASI_Mm01_00052947 predicted 993
7 SASI_Mm01_00052949 predicted 419
8 SASI_Mm01_00052950 predicted 712
9 SASI_Mm02_00317425 predicted 292
10 SASI_Mm01_00052951 predicted 308
11 SASI_Mm01_00052942 predicted 593
12 SASI_Mm01_00052948 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009907
VALIDATED
CLN3 MISSION shRNA Bacterial Glycerol Stock
ceroid-lipofuscinosis, neuronal 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009907.3-440s21c3
Sequence:CCGGCCACAACAGCTCATCTCGATTCTCGAGAATCGAGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009907.3-1393s21c1
Sequence:CCGGGTGACAAGCACCGAGAGTTTGCTCGAGCAAACTCTCGGTGCTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009907.3-1833s21c1
Sequence:CCGGTCACGTCTGACTGGGATATACCTCGAGGTATATCCCAGTCAGACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009907.3-855s21c1
Sequence:CCGGCTGCTGCTAGCCAGCTATTTCCTCGAGGAAATAGCTGGCTAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009907.3-319s21c1
Sequence:CCGGTCTTGGGTCTTTGCAACAATTCTCGAGAATTGTTGCAAAGACCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009907.2-1643s1c1
Sequence:CCGGGCCCTTCTAATAAATGCTTATCTCGAGATAAGCATTTATTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-1342s1c1
Sequence:CCGGCGTGAATACCTTCCACAACATCTCGAGATGTTGTGGAAGGTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-751s1c1
Sequence:CCGGGCTTCTTGGATCGCTGTCTTACTCGAGTAAGACAGCGATCCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-1179s1c1
Sequence:CCGGCTTCTCTCCAATGTTGCCGAACTCGAGTTCGGCAACATTGGAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-424s1c1
Sequence:CCGGCCACAACAGCTCATCTCGATTCTCGAGAATCGAGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009907
VALIDATED
CLN3 MISSION shRNA shRNA Plasmid DNA
ceroid-lipofuscinosis, neuronal 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009907.3-440s21c3
Sequence:CCGGCCACAACAGCTCATCTCGATTCTCGAGAATCGAGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009907.3-1393s21c1
Sequence:CCGGGTGACAAGCACCGAGAGTTTGCTCGAGCAAACTCTCGGTGCTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009907.3-1833s21c1
Sequence:CCGGTCACGTCTGACTGGGATATACCTCGAGGTATATCCCAGTCAGACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009907.3-855s21c1
Sequence:CCGGCTGCTGCTAGCCAGCTATTTCCTCGAGGAAATAGCTGGCTAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009907.3-319s21c1
Sequence:CCGGTCTTGGGTCTTTGCAACAATTCTCGAGAATTGTTGCAAAGACCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009907.2-1643s1c1
Sequence:CCGGGCCCTTCTAATAAATGCTTATCTCGAGATAAGCATTTATTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-1342s1c1
Sequence:CCGGCGTGAATACCTTCCACAACATCTCGAGATGTTGTGGAAGGTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-751s1c1
Sequence:CCGGGCTTCTTGGATCGCTGTCTTACTCGAGTAAGACAGCGATCCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-1179s1c1
Sequence:CCGGCTTCTCTCCAATGTTGCCGAACTCGAGTTCGGCAACATTGGAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-424s1c1
Sequence:CCGGCCACAACAGCTCATCTCGATTCTCGAGAATCGAGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009907
VALIDATED
CLN3 MISSION shRNA Lentiviral Transduction Particles
ceroid-lipofuscinosis, neuronal 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009907.3-440s21c3
Sequence:CCGGCCACAACAGCTCATCTCGATTCTCGAGAATCGAGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009907.3-1393s21c1
Sequence:CCGGGTGACAAGCACCGAGAGTTTGCTCGAGCAAACTCTCGGTGCTTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009907.3-1833s21c1
Sequence:CCGGTCACGTCTGACTGGGATATACCTCGAGGTATATCCCAGTCAGACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009907.3-855s21c1
Sequence:CCGGCTGCTGCTAGCCAGCTATTTCCTCGAGGAAATAGCTGGCTAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009907.3-319s21c1
Sequence:CCGGTCTTGGGTCTTTGCAACAATTCTCGAGAATTGTTGCAAAGACCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009907.2-1643s1c1
Sequence:CCGGGCCCTTCTAATAAATGCTTATCTCGAGATAAGCATTTATTAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-1342s1c1
Sequence:CCGGCGTGAATACCTTCCACAACATCTCGAGATGTTGTGGAAGGTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-751s1c1
Sequence:CCGGGCTTCTTGGATCGCTGTCTTACTCGAGTAAGACAGCGATCCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-1179s1c1
Sequence:CCGGCTTCTCTCCAATGTTGCCGAACTCGAGTTCGGCAACATTGGAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009907.2-424s1c1
Sequence:CCGGCCACAACAGCTCATCTCGATTCTCGAGAATCGAGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000086
VALIDATED
CLN3 MISSION shRNA Bacterial Glycerol Stock
ceroid-lipofuscinosis, neuronal 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000086.2-1653s21c1
Sequence:CCGGTCAGGACGCAGGTCACATTCACTCGAGTGAATGTGACCTGCGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000086.2-1438s21c1
Sequence:CCGGACCTCGTCTTCCTGATCATTCCTCGAGGAATGATCAGGAAGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000086.2-1190s21c1
Sequence:CCGGCGTAGTTTACTTTGCCGAGTACTCGAGTACTCGGCAAAGTAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000086.2-1000s21c1
Sequence:CCGGGCTATTTCTTGTTGCTCACATCTCGAGATGTGAGCAACAAGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000086.2-572s21c1
Sequence:CCGGCCACAACAGCTCATCACGATTCTCGAGAATCGTGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000086.1-1004s1c1
Sequence:CCGGCGTAGTTTACTTTGCCGAGTACTCGAGTACTCGGCAAAGTAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000086.1-814s1c1
Sequence:CCGGGCTATTTCTTGTTGCTCACATCTCGAGATGTGAGCAACAAGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000086.1-281s1c1
Sequence:CCGGCAACTTCTCTTATGTGGTGATCTCGAGATCACCACATAAGAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000086.1-386s1c1
Sequence:CCGGCCACAACAGCTCATCACGATTCTCGAGAATCGTGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000086.1-1005s1c1
Sequence:CCGGGTAGTTTACTTTGCCGAGTATCTCGAGATACTCGGCAAAGTAAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000086
VALIDATED
CLN3 MISSION shRNA shRNA Plasmid DNA
ceroid-lipofuscinosis, neuronal 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000086.2-1653s21c1
Sequence:CCGGTCAGGACGCAGGTCACATTCACTCGAGTGAATGTGACCTGCGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000086.2-1438s21c1
Sequence:CCGGACCTCGTCTTCCTGATCATTCCTCGAGGAATGATCAGGAAGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000086.2-1190s21c1
Sequence:CCGGCGTAGTTTACTTTGCCGAGTACTCGAGTACTCGGCAAAGTAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000086.2-1000s21c1
Sequence:CCGGGCTATTTCTTGTTGCTCACATCTCGAGATGTGAGCAACAAGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000086.2-572s21c1
Sequence:CCGGCCACAACAGCTCATCACGATTCTCGAGAATCGTGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000086.1-1004s1c1
Sequence:CCGGCGTAGTTTACTTTGCCGAGTACTCGAGTACTCGGCAAAGTAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000086.1-814s1c1
Sequence:CCGGGCTATTTCTTGTTGCTCACATCTCGAGATGTGAGCAACAAGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000086.1-281s1c1
Sequence:CCGGCAACTTCTCTTATGTGGTGATCTCGAGATCACCACATAAGAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000086.1-386s1c1
Sequence:CCGGCCACAACAGCTCATCACGATTCTCGAGAATCGTGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000086.1-1005s1c1
Sequence:CCGGGTAGTTTACTTTGCCGAGTATCTCGAGATACTCGGCAAAGTAAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000086
VALIDATED
CLN3 MISSION shRNA Lentiviral Transduction Particles
ceroid-lipofuscinosis, neuronal 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000086.2-1653s21c1
Sequence:CCGGTCAGGACGCAGGTCACATTCACTCGAGTGAATGTGACCTGCGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000086.2-1438s21c1
Sequence:CCGGACCTCGTCTTCCTGATCATTCCTCGAGGAATGATCAGGAAGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000086.2-1190s21c1
Sequence:CCGGCGTAGTTTACTTTGCCGAGTACTCGAGTACTCGGCAAAGTAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000086.2-1000s21c1
Sequence:CCGGGCTATTTCTTGTTGCTCACATCTCGAGATGTGAGCAACAAGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000086.2-572s21c1
Sequence:CCGGCCACAACAGCTCATCACGATTCTCGAGAATCGTGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000086.1-1004s1c1
Sequence:CCGGCGTAGTTTACTTTGCCGAGTACTCGAGTACTCGGCAAAGTAAACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000086.1-814s1c1
Sequence:CCGGGCTATTTCTTGTTGCTCACATCTCGAGATGTGAGCAACAAGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000086.1-281s1c1
Sequence:CCGGCAACTTCTCTTATGTGGTGATCTCGAGATCACCACATAAGAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000086.1-386s1c1
Sequence:CCGGCCACAACAGCTCATCACGATTCTCGAGAATCGTGATGAGCTGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000086.1-1005s1c1
Sequence:CCGGGTAGTTTACTTTGCCGAGTATCTCGAGATACTCGGCAAAGTAAACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks