EMAIL THIS PAGE TO A FRIEND

CLN5

ceroid-lipofuscinosis, neuronal 5

67 Gene Product Result for
Synonyms: NCL
UniProtKB ID: O75503
Gene ID:
Human(1203) Summary: This gene is one of eight which have been associated with neuronal ceroid lipofuscinoses (NCL). Also referred to as Batten disease, NCL comprises a class of autosomal recessive, neurodegenerative disorders affecting children. The genes responsible likely encode proteins involved in the degradation of post-translationally modified proteins in lysosomes. The primary defect in NCL disorders is thought to be associated with lysosomal storage function.[provided by RefSeq, Oct 2008]
Mouse(211286) ceroid-lipofuscinosis, neuronal 5
Rat(306128) ceroid-lipofuscinosis, neuronal 5
sheep(100034668) ceroid-lipofuscinosis, neuronal 5
naked mole-rat(101715781) ceroid-lipofuscinosis, neuronal 5
domestic guinea pig(100726787) ceroid-lipofuscinosis, neuronal 5
Zebrafish(569407) ceroid-lipofuscinosis, neuronal 5
domestic cat(101085427) ceroid-lipofuscinosis, neuronal 5
cow(529186) ceroid-lipofuscinosis, neuronal 5
dog(485498) ceroid-lipofuscinosis, neuronal 5
chicken(101752092) ceroid-lipofuscinosis, neuronal 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006493 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006493 Rosetta Predictions human pricing
XM_001076756 Rosetta Predictions rat pricing
XM_224477 Rosetta Predictions rat pricing
NM_001033242 Rosetta Predictions mouse pricing
XM_001003197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020970 predicted 1973
2 SASI_Hs01_00020971 predicted 2518
3 SASI_Hs02_00341692 predicted 1695
4 SASI_Hs01_00020972 predicted 2231
5 SASI_Hs01_00020973 predicted 2373
6 SASI_Hs01_00020975 predicted 1825
7 SASI_Hs01_00020976 predicted 2195
8 SASI_Hs01_00020977 predicted 2125
9 SASI_Hs01_00020978 predicted 1792
10 SASI_Hs02_00341693 predicted 2191
11 SASI_Hs01_00020974 predicted 2552
12 SASI_Hs01_00020979 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354416 predicted 615
2 SASI_Rn02_00354417 predicted 552
3 SASI_Rn02_00354418 predicted 323
4 SASI_Rn02_00354419 predicted 266
5 SASI_Rn02_00354420 predicted 587
6 SASI_Rn02_00354421 predicted 489
7 SASI_Rn02_00354422 predicted 527
8 SASI_Rn02_00354423 predicted 383
9 SASI_Rn02_00354424 predicted 299
10 SASI_Rn02_00354425 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382008 predicted 1125
2 SASI_Rn02_00382009 predicted 893
3 SASI_Rn02_00382010 predicted 1107
4 SASI_Rn02_00382011 predicted 765
5 SASI_Rn02_00382012 predicted 994
6 SASI_Rn02_00382013 predicted 1362
7 SASI_Rn02_00382014 predicted 779
8 SASI_Rn02_00382015 predicted 879
9 SASI_Rn02_00382016 predicted 645
10 SASI_Rn02_00382017 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288389 predicted 1136
2 SASI_Mm02_00288390 predicted 1117
3 SASI_Mm02_00288391 predicted 243
4 SASI_Mm02_00288392 predicted 1121
5 SASI_Mm02_00288393 predicted 674
6 SASI_Mm02_00288394 predicted 274
7 SASI_Mm02_00288395 predicted 468
8 SASI_Mm02_00288396 predicted 460
9 SASI_Mm02_00288397 predicted 522
10 SASI_Mm02_00288398 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208330 predicted 780
2 SASI_Mm01_00208331 predicted 1119
3 SASI_Mm01_00208332 predicted 237
4 SASI_Mm01_00208333 predicted 1122
5 SASI_Mm01_00208334 predicted 676
6 SASI_Mm01_00208335 predicted 276
7 SASI_Mm01_00208336 predicted 468
8 SASI_Mm01_00208337 predicted 458
9 SASI_Mm01_00208338 predicted 530
10 SASI_Mm01_00208339 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006493
VALIDATED
CLN5 MISSION shRNA Bacterial Glycerol Stock
ceroid-lipofuscinosis, neuronal 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006493.1-2805s1c1
Sequence:CCGGCCAGGGTCCTACAGATAGATACTCGAGTATCTATCTGTAGGACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006493.1-2178s1c1
Sequence:CCGGGCAGAGTTCAAGAACATAGAACTCGAGTTCTATGTTCTTGAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006493.1-1641s1c1
Sequence:CCGGCCTTATTGTCAAGCTAAGTATCTCGAGATACTTAGCTTGACAATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006493.1-2477s1c1
Sequence:CCGGCCCTTTACCTATCAGAAACAACTCGAGTTGTTTCTGATAGGTAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006493.1-2336s1c1
Sequence:CCGGGCCAACTAAAGAATTTCTGTTCTCGAGAACAGAAATTCTTTAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006493.2-1422s21c1
Sequence:CCGGAGCTGAAATTCGTACTATATTCTCGAGAATATAGTACGAATTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006493.2-1021s21c1
Sequence:CCGGGACTCTTGGTTTAGCCATAAACTCGAGTTTATGGCTAAACCAAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006493.2-377s21c1
Sequence:CCGGCCTTATTGTCAAGCTAAGTATCTCGAGATACTTAGCTTGACAATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006493.2-535s21c1
Sequence:CCGGTGGATTCAGAAGTACATTAACCTCGAGGTTAATGTACTTCTGAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006493.2-718s21c1
Sequence:CCGGAGTTCAAGTAGCAACTATATCCTCGAGGATATAGTTGCTACTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006493
VALIDATED
CLN5 MISSION shRNA shRNA Plasmid DNA
ceroid-lipofuscinosis, neuronal 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006493.1-2805s1c1
Sequence:CCGGCCAGGGTCCTACAGATAGATACTCGAGTATCTATCTGTAGGACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006493.1-2178s1c1
Sequence:CCGGGCAGAGTTCAAGAACATAGAACTCGAGTTCTATGTTCTTGAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006493.1-1641s1c1
Sequence:CCGGCCTTATTGTCAAGCTAAGTATCTCGAGATACTTAGCTTGACAATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006493.1-2477s1c1
Sequence:CCGGCCCTTTACCTATCAGAAACAACTCGAGTTGTTTCTGATAGGTAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006493.1-2336s1c1
Sequence:CCGGGCCAACTAAAGAATTTCTGTTCTCGAGAACAGAAATTCTTTAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006493.2-1422s21c1
Sequence:CCGGAGCTGAAATTCGTACTATATTCTCGAGAATATAGTACGAATTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006493.2-1021s21c1
Sequence:CCGGGACTCTTGGTTTAGCCATAAACTCGAGTTTATGGCTAAACCAAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006493.2-377s21c1
Sequence:CCGGCCTTATTGTCAAGCTAAGTATCTCGAGATACTTAGCTTGACAATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006493.2-535s21c1
Sequence:CCGGTGGATTCAGAAGTACATTAACCTCGAGGTTAATGTACTTCTGAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006493.2-718s21c1
Sequence:CCGGAGTTCAAGTAGCAACTATATCCTCGAGGATATAGTTGCTACTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006493
VALIDATED
CLN5 MISSION shRNA Lentiviral Transduction Particles
ceroid-lipofuscinosis, neuronal 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006493.1-2805s1c1
Sequence:CCGGCCAGGGTCCTACAGATAGATACTCGAGTATCTATCTGTAGGACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006493.1-2178s1c1
Sequence:CCGGGCAGAGTTCAAGAACATAGAACTCGAGTTCTATGTTCTTGAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006493.1-1641s1c1
Sequence:CCGGCCTTATTGTCAAGCTAAGTATCTCGAGATACTTAGCTTGACAATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006493.1-2477s1c1
Sequence:CCGGCCCTTTACCTATCAGAAACAACTCGAGTTGTTTCTGATAGGTAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006493.1-2336s1c1
Sequence:CCGGGCCAACTAAAGAATTTCTGTTCTCGAGAACAGAAATTCTTTAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006493.2-1422s21c1
Sequence:CCGGAGCTGAAATTCGTACTATATTCTCGAGAATATAGTACGAATTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006493.2-1021s21c1
Sequence:CCGGGACTCTTGGTTTAGCCATAAACTCGAGTTTATGGCTAAACCAAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006493.2-377s21c1
Sequence:CCGGCCTTATTGTCAAGCTAAGTATCTCGAGATACTTAGCTTGACAATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006493.2-535s21c1
Sequence:CCGGTGGATTCAGAAGTACATTAACCTCGAGGTTAATGTACTTCTGAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006493.2-718s21c1
Sequence:CCGGAGTTCAAGTAGCAACTATATCCTCGAGGATATAGTTGCTACTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033242
VALIDATED
CLN5 MISSION shRNA Bacterial Glycerol Stock
ceroid-lipofuscinosis, neuronal 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033242.1-760s21c1
Sequence:CCGGGTCCTACGACTGTTCGAATTTCTCGAGAAATTCGAACAGTCGTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033242.1-282s21c1
Sequence:CCGGCCTACTGTCAAGCTAAGTATACTCGAGTATACTTAGCTTGACAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033242.1-1124s21c1
Sequence:CCGGCCTACCCGACATACAACATTTCTCGAGAAATGTTGTATGTCGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033242.1-862s21c1
Sequence:CCGGTTACAGTGGAGAGCCTATTTACTCGAGTAAATAGGCTCTCCACTGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033242.1-1295s21c1
Sequence:CCGGAGAGTAGCAGAAACCGTAATTCTCGAGAATTACGGTTTCTGCTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033242
VALIDATED
CLN5 MISSION shRNA shRNA Plasmid DNA
ceroid-lipofuscinosis, neuronal 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033242.1-760s21c1
Sequence:CCGGGTCCTACGACTGTTCGAATTTCTCGAGAAATTCGAACAGTCGTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033242.1-282s21c1
Sequence:CCGGCCTACTGTCAAGCTAAGTATACTCGAGTATACTTAGCTTGACAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033242.1-1124s21c1
Sequence:CCGGCCTACCCGACATACAACATTTCTCGAGAAATGTTGTATGTCGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033242.1-862s21c1
Sequence:CCGGTTACAGTGGAGAGCCTATTTACTCGAGTAAATAGGCTCTCCACTGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033242.1-1295s21c1
Sequence:CCGGAGAGTAGCAGAAACCGTAATTCTCGAGAATTACGGTTTCTGCTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033242
VALIDATED
CLN5 MISSION shRNA Lentiviral Transduction Particles
ceroid-lipofuscinosis, neuronal 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033242.1-760s21c1
Sequence:CCGGGTCCTACGACTGTTCGAATTTCTCGAGAAATTCGAACAGTCGTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033242.1-282s21c1
Sequence:CCGGCCTACTGTCAAGCTAAGTATACTCGAGTATACTTAGCTTGACAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033242.1-1124s21c1
Sequence:CCGGCCTACCCGACATACAACATTTCTCGAGAAATGTTGTATGTCGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033242.1-862s21c1
Sequence:CCGGTTACAGTGGAGAGCCTATTTACTCGAGTAAATAGGCTCTCCACTGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033242.1-1295s21c1
Sequence:CCGGAGAGTAGCAGAAACCGTAATTCTCGAGAATTACGGTTTCTGCTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)