EMAIL THIS PAGE TO A FRIEND

CLN6

ceroid-lipofuscinosis, neuronal 6, late infantile, variant

Synonyms: CLN4A HsT18960 nclf
UniProtKB ID: Q9NWW5, A8K560, Q6IAB1, Q96SR0
Gene ID:
Human(54982) Summary: This gene is one of eight which have been associated with neuronal ceroid lipofuscinoses (NCL). Also referred to as Batten disease, NCL comprises a class of autosomal recessive, neurodegenerative disorders affecting children. The genes responsible likely encode proteins involved in the degradation of post-translationally modified proteins in lysosomes. The primary defect in NCL disorders is thought to be associated with lysosomal storage function. [provided by RefSeq, Oct 2008]
Mouse(76524) ceroid-lipofuscinosis, neuronal 6
Rat(315746) ceroid-lipofuscinosis, neuronal 6, late infantile, variant
chicken(415558) ceroid-lipofuscinosis, neuronal 6, late infantile, variant
cow(617615) ceroid-lipofuscinosis, neuronal 6, late infantile, variant
domestic cat(101099969) ceroid-lipofuscinosis, neuronal 6, late infantile, variant
dog(497068) ceroid-lipofuscinosis, neuronal 6, late infantile, variant
domestic guinea pig(100730423) ceroid-lipofuscinosis, neuronal 6, late infantile, variant
naked mole-rat(101708242) ceroid-lipofuscinosis, neuronal 6, late infantile, variant
sheep(678673) ceroid-lipofuscinosis, neuronal 6, late infantile, variant
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017882 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017882 Rosetta Predictions human pricing
XM_001074158 Rosetta Predictions rat pricing
XM_236325 Rosetta Predictions rat pricing
NM_001033175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247115 predicted 307
2 SASI_Hs01_00247116 predicted 594
3 SASI_Hs01_00247118 predicted 900
4 SASI_Hs01_00247120 predicted 230
5 SASI_Hs01_00247121 predicted 357
6 SASI_Hs01_00247122 predicted 696
7 SASI_Hs01_00247124 predicted 614
8 SASI_Hs02_00350824 predicted 438
9 SASI_Hs02_00350825 predicted 688
10 SASI_Hs02_00350826 predicted 680
11 SASI_Hs01_00247117 predicted 250
12 SASI_Hs01_00247119 predicted 293
13 SASI_Hs01_00247123 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345220 predicted 212
2 SASI_Rn02_00345221 predicted 381
3 SASI_Rn02_00345222 predicted 526
4 SASI_Rn02_00345223 predicted 855
5 SASI_Rn02_00345224 predicted 759
6 SASI_Rn02_00345225 predicted 468
7 SASI_Rn02_00345226 predicted 764
8 SASI_Rn02_00345227 predicted 417
9 SASI_Rn02_00345228 predicted 960
10 SASI_Rn02_00345229 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389974 predicted 213
2 SASI_Rn02_00389975 predicted 380
3 SASI_Rn02_00389976 predicted 527
4 SASI_Rn02_00389977 predicted 850
5 SASI_Rn02_00389978 predicted 759
6 SASI_Rn02_00389979 predicted 474
7 SASI_Rn02_00389980 predicted 762
8 SASI_Rn02_00389981 predicted 413
9 SASI_Rn02_00389982 predicted 957
10 SASI_Rn02_00389983 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048923 predicted 930
2 SASI_Mm01_00048924 predicted 1504
3 SASI_Mm01_00048925 predicted 858
4 SASI_Mm01_00048926 predicted 225
5 SASI_Mm01_00048927 predicted 595
6 SASI_Mm02_00288287 predicted 902
7 SASI_Mm01_00048928 predicted 661
8 SASI_Mm01_00048929 predicted 287
9 SASI_Mm01_00048930 predicted 831
10 SASI_Mm01_00048931 predicted 331
11 SASI_Mm01_00048932 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017882
VALIDATED
CLN6 MISSION shRNA Bacterial Glycerol Stock
ceroid-lipofuscinosis, neuronal 6, late infantile, variant
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017882.2-637s21c1
Sequence:CCGGAGACGCTGATCGACTCCTTTGCTCGAGCAAAGGAGTCGATCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017882.2-319s21c1
Sequence:CCGGAGAACTGGGTTCTGGACTTTGCTCGAGCAAAGTCCAGAACCCAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017882.2-731s21c1
Sequence:CCGGGTACTTCAGCGGCTGCTTTACCTCGAGGTAAAGCAGCCGCTGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-607s1c1
Sequence:CCGGGCTCTACTATTATGATGAGTACTCGAGTACTCATCATAATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-604s1c1
Sequence:CCGGGCTGCTCTACTATTATGATGACTCGAGTCATCATAATAGTAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-699s1c1
Sequence:CCGGCCTCTAAAGCTGAGAGCTTGACTCGAGTCAAGCTCTCAGCTTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-316s1c1
Sequence:CCGGCGAGTGGTTTCCACTCAACAACTCGAGTTGTTGAGTGGAAACCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-1243s1c1
Sequence:CCGGCCGTCAAGTTTCTGTTTGATTCTCGAGAATCAAACAGAAACTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017882
VALIDATED
CLN6 MISSION shRNA shRNA Plasmid DNA
ceroid-lipofuscinosis, neuronal 6, late infantile, variant
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017882.2-637s21c1
Sequence:CCGGAGACGCTGATCGACTCCTTTGCTCGAGCAAAGGAGTCGATCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017882.2-319s21c1
Sequence:CCGGAGAACTGGGTTCTGGACTTTGCTCGAGCAAAGTCCAGAACCCAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017882.2-731s21c1
Sequence:CCGGGTACTTCAGCGGCTGCTTTACCTCGAGGTAAAGCAGCCGCTGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-607s1c1
Sequence:CCGGGCTCTACTATTATGATGAGTACTCGAGTACTCATCATAATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-604s1c1
Sequence:CCGGGCTGCTCTACTATTATGATGACTCGAGTCATCATAATAGTAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-699s1c1
Sequence:CCGGCCTCTAAAGCTGAGAGCTTGACTCGAGTCAAGCTCTCAGCTTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-316s1c1
Sequence:CCGGCGAGTGGTTTCCACTCAACAACTCGAGTTGTTGAGTGGAAACCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-1243s1c1
Sequence:CCGGCCGTCAAGTTTCTGTTTGATTCTCGAGAATCAAACAGAAACTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017882
VALIDATED
CLN6 MISSION shRNA Lentiviral Transduction Particles
ceroid-lipofuscinosis, neuronal 6, late infantile, variant
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017882.2-637s21c1
Sequence:CCGGAGACGCTGATCGACTCCTTTGCTCGAGCAAAGGAGTCGATCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017882.2-319s21c1
Sequence:CCGGAGAACTGGGTTCTGGACTTTGCTCGAGCAAAGTCCAGAACCCAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017882.2-731s21c1
Sequence:CCGGGTACTTCAGCGGCTGCTTTACCTCGAGGTAAAGCAGCCGCTGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-607s1c1
Sequence:CCGGGCTCTACTATTATGATGAGTACTCGAGTACTCATCATAATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-604s1c1
Sequence:CCGGGCTGCTCTACTATTATGATGACTCGAGTCATCATAATAGTAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-699s1c1
Sequence:CCGGCCTCTAAAGCTGAGAGCTTGACTCGAGTCAAGCTCTCAGCTTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-316s1c1
Sequence:CCGGCGAGTGGTTTCCACTCAACAACTCGAGTTGTTGAGTGGAAACCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017882.1-1243s1c1
Sequence:CCGGCCGTCAAGTTTCTGTTTGATTCTCGAGAATCAAACAGAAACTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033175
VALIDATED
CLN6 MISSION shRNA Bacterial Glycerol Stock
ceroid-lipofuscinosis, neuronal 6, late infantile, variant
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033175.2-582s21c1
Sequence:CCGGTTGAGCTGTTGTACTACTATGCTCGAGCATAGTAGTACAACAGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033175.2-858s21c1
Sequence:CCGGACGGCCTCTTCCTCTTGTATTCTCGAGAATACAAGAGGAAGAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033175.2-368s21c1
Sequence:CCGGTTCCTGCTGCTAAAGCTTATTCTCGAGAATAAGCTTTAGCAGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033175.2-272s21c1
Sequence:CCGGCCCATTGCCATGCTGGTATTCCTCGAGGAATACCAGCATGGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033175.1-590s1c1
Sequence:CCGGGTTGTACTACTATGACGAGTACTCGAGTACTCGTCATAGTAGTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033175.1-1064s1c1
Sequence:CCGGGCATACATGCACCGTGGTAATCTCGAGATTACCACGGTGCATGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033175
VALIDATED
CLN6 MISSION shRNA shRNA Plasmid DNA
ceroid-lipofuscinosis, neuronal 6, late infantile, variant
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033175.2-582s21c1
Sequence:CCGGTTGAGCTGTTGTACTACTATGCTCGAGCATAGTAGTACAACAGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033175.2-858s21c1
Sequence:CCGGACGGCCTCTTCCTCTTGTATTCTCGAGAATACAAGAGGAAGAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033175.2-368s21c1
Sequence:CCGGTTCCTGCTGCTAAAGCTTATTCTCGAGAATAAGCTTTAGCAGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033175.2-272s21c1
Sequence:CCGGCCCATTGCCATGCTGGTATTCCTCGAGGAATACCAGCATGGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033175.1-590s1c1
Sequence:CCGGGTTGTACTACTATGACGAGTACTCGAGTACTCGTCATAGTAGTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033175.1-1064s1c1
Sequence:CCGGGCATACATGCACCGTGGTAATCTCGAGATTACCACGGTGCATGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033175
VALIDATED
CLN6 MISSION shRNA Lentiviral Transduction Particles
ceroid-lipofuscinosis, neuronal 6, late infantile, variant
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033175.2-582s21c1
Sequence:CCGGTTGAGCTGTTGTACTACTATGCTCGAGCATAGTAGTACAACAGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033175.2-858s21c1
Sequence:CCGGACGGCCTCTTCCTCTTGTATTCTCGAGAATACAAGAGGAAGAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033175.2-368s21c1
Sequence:CCGGTTCCTGCTGCTAAAGCTTATTCTCGAGAATAAGCTTTAGCAGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033175.2-272s21c1
Sequence:CCGGCCCATTGCCATGCTGGTATTCCTCGAGGAATACCAGCATGGCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033175.1-590s1c1
Sequence:CCGGGTTGTACTACTATGACGAGTACTCGAGTACTCGTCATAGTAGTACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190096    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033175.1-1064s1c1
Sequence:CCGGGCATACATGCACCGTGGTAATCTCGAGATTACCACGGTGCATGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks