EMAIL THIS PAGE TO A FRIEND

CLN8

ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)

43 Gene Product Result for
Synonyms: C8orf61 EPMR
UniProtKB ID: Q9UBY8, Q86U71, Q96I95
Gene ID:
Human(2055) Summary: This gene encodes a transmembrane protein belonging to a family of proteins containing TLC domains, which are postulated to function in lipid synthesis, transport, or sensing. The protein localizes to the endoplasmic reticulum (ER), and may recycle between the ER and ER-Golgi intermediate compartment. Mutations in this gene are associated with progressive epilepsy with mental retardation (EMPR), which is a subtype of neuronal ceroid lipofuscinoses (NCL). Patients with mutations in this gene have altered levels of sphingolipid and phospholipids in the brain. [provided by RefSeq, Jul 2008]
Mouse(26889) ceroid-lipofuscinosis, neuronal 8
Rat(306619) ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
Zebrafish(100136870) ceroid-lipofuscinosis, neuronal 8
cow(530874) ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
domestic cat(101100714) ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
dog(488558) ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
chicken(421902) ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
sheep(101104038) ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
naked mole-rat(101702192) ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
domestic guinea pig(100717237) ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100448 Anti-CLN8 (ab1) antibody produced in rabbit affinity isolated antibody human, guinea pig, canine, horse
western blot pricing
SAB2100449 Anti-CLN8 (ab2) antibody produced in rabbit affinity isolated antibody canine, rabbit, human, bovine, guinea pig, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012000 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012000 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012000 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018941 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018941 Rosetta Predictions human pricing
NM_001007686 Rosetta Predictions rat pricing
NM_012000 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016766 predicted 1028
2 SASI_Hs01_00016767 predicted 444
3 SASI_Hs01_00016768 predicted 477
4 SASI_Hs01_00016769 predicted 814
5 SASI_Hs01_00016770 predicted 903
6 SASI_Hs01_00016771 predicted 772
7 SASI_Hs01_00016772 predicted 1050
8 SASI_Hs01_00016773 predicted 1017
9 SASI_Hs01_00016774 predicted 400
10 SASI_Hs01_00016775 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198831 predicted 286
2 SASI_Rn01_00038569 predicted 870
3 SASI_Rn01_00038570 predicted 1116
4 SASI_Rn01_00038571 predicted 662
5 SASI_Rn01_00038572 predicted 489
6 SASI_Rn02_00198832 predicted 1148
7 SASI_Rn01_00038573 predicted 709
8 SASI_Rn01_00038574 predicted 1149
9 SASI_Rn01_00038576 predicted 624
10 SASI_Rn01_00038578 predicted 886
11 SASI_Rn01_00038575 predicted 1102
12 SASI_Rn01_00038577 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034934 predicted 1421
2 SASI_Mm01_00034935 predicted 1665
3 SASI_Mm01_00034936 predicted 1622
4 SASI_Mm01_00034937 predicted 1682
5 SASI_Mm01_00034938 predicted 793
6 SASI_Mm01_00034940 predicted 1278
7 SASI_Mm01_00034941 predicted 1939
8 SASI_Mm02_00321939 predicted 1164
9 SASI_Mm01_00034942 predicted 1700
10 SASI_Mm01_00034943 predicted 753
11 SASI_Mm01_00034939 predicted 1414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012000
VALIDATED
CLN8 MISSION shRNA Bacterial Glycerol Stock
ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012000.2-2131s1c1
Sequence:CCGGGCCCTTACTTTGTGTTCCTAACTCGAGTTAGGAACACAAAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012000.2-927s1c1
Sequence:CCGGCCAGTGGCTAATGATCCACATCTCGAGATGTGGATCATTAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012000.2-613s1c1
Sequence:CCGGCCCGTGCTCTATGCCGACAAACTCGAGTTTGTCGGCATAGAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012000.2-760s1c1
Sequence:CCGGCACCACCTCTTTGCCTTTCTTCTCGAGAAGAAAGGCAAAGAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012000.2-1086s1c1
Sequence:CCGGCCCTTACTGGACACACAAGAACTCGAGTTCTTGTGTGTCCAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-964s21c1
Sequence:CCGGCCCGTGCTCTATGCCGACAAACTCGAGTTTGTCGGCATAGAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-1278s21c1
Sequence:CCGGCCAGTGGCTAATGATCCACATCTCGAGATGTGGATCATTAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-1111s21c1
Sequence:CCGGCACCACCTCTTTGCCTTTCTTCTCGAGAAGAAAGGCAAAGAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-1437s21c1
Sequence:CCGGCCCTTACTGGACACACAAGAACTCGAGTTCTTGTGTGTCCAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012000
VALIDATED
CLN8 MISSION shRNA shRNA Plasmid DNA
ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012000.2-2131s1c1
Sequence:CCGGGCCCTTACTTTGTGTTCCTAACTCGAGTTAGGAACACAAAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012000.2-927s1c1
Sequence:CCGGCCAGTGGCTAATGATCCACATCTCGAGATGTGGATCATTAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012000.2-613s1c1
Sequence:CCGGCCCGTGCTCTATGCCGACAAACTCGAGTTTGTCGGCATAGAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012000.2-760s1c1
Sequence:CCGGCACCACCTCTTTGCCTTTCTTCTCGAGAAGAAAGGCAAAGAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012000.2-1086s1c1
Sequence:CCGGCCCTTACTGGACACACAAGAACTCGAGTTCTTGTGTGTCCAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-964s21c1
Sequence:CCGGCCCGTGCTCTATGCCGACAAACTCGAGTTTGTCGGCATAGAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-1278s21c1
Sequence:CCGGCCAGTGGCTAATGATCCACATCTCGAGATGTGGATCATTAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-1111s21c1
Sequence:CCGGCACCACCTCTTTGCCTTTCTTCTCGAGAAGAAAGGCAAAGAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-1437s21c1
Sequence:CCGGCCCTTACTGGACACACAAGAACTCGAGTTCTTGTGTGTCCAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012000
VALIDATED
CLN8 MISSION shRNA Lentiviral Transduction Particles
ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012000.2-2131s1c1
Sequence:CCGGGCCCTTACTTTGTGTTCCTAACTCGAGTTAGGAACACAAAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012000.2-927s1c1
Sequence:CCGGCCAGTGGCTAATGATCCACATCTCGAGATGTGGATCATTAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012000.2-613s1c1
Sequence:CCGGCCCGTGCTCTATGCCGACAAACTCGAGTTTGTCGGCATAGAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012000.2-760s1c1
Sequence:CCGGCACCACCTCTTTGCCTTTCTTCTCGAGAAGAAAGGCAAAGAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012000.2-1086s1c1
Sequence:CCGGCCCTTACTGGACACACAAGAACTCGAGTTCTTGTGTGTCCAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-964s21c1
Sequence:CCGGCCCGTGCTCTATGCCGACAAACTCGAGTTTGTCGGCATAGAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-1278s21c1
Sequence:CCGGCCAGTGGCTAATGATCCACATCTCGAGATGTGGATCATTAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-1111s21c1
Sequence:CCGGCACCACCTCTTTGCCTTTCTTCTCGAGAAGAAAGGCAAAGAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012000.3-1437s21c1
Sequence:CCGGCCCTTACTGGACACACAAGAACTCGAGTTCTTGTGTGTCCAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018941
VALIDATED
CLN8 MISSION shRNA Bacterial Glycerol Stock
ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018941.2-949s1c1
Sequence:CCGGGCTCTGCTTACGCTAATCATTCTCGAGAATGATTAGCGTAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018941.2-331s1c1
Sequence:CCGGGTCTTCTACTTGGGCGTCTTTCTCGAGAAAGACGCCCAAGTAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018941.2-1074s1c1
Sequence:CCGGGCTGCGGAAGAAGAGGCCATACTCGAGTATGGCCTCTTCTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018941.2-381s1c1
Sequence:CCGGGAATGCCACTTACCGTTCTTTCTCGAGAAAGAACGGTAAGTGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018941.2-919s1c1
Sequence:CCGGCCTCATTTGACACTGTTCCTTCTCGAGAAGGAACAGTGTCAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018941.3-889s21c1
Sequence:CCGGGGCTGATGATTCACATGTTTCCTCGAGGAAACATGTGAATCATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018941.3-828s21c1
Sequence:CCGGGTTTCCTGGATGCTCTTAAAGCTCGAGCTTTAAGAGCATCCAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018941.3-1318s21c1
Sequence:CCGGTTGAAGTAGCTACAAAGTATTCTCGAGAATACTTTGTAGCTACTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018941.3-679s21c1
Sequence:CCGGACTTGATCTTCCGGACATTTGCTCGAGCAAATGTCCGGAAGATCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018941
VALIDATED
CLN8 MISSION shRNA shRNA Plasmid DNA
ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018941.2-949s1c1
Sequence:CCGGGCTCTGCTTACGCTAATCATTCTCGAGAATGATTAGCGTAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018941.2-331s1c1
Sequence:CCGGGTCTTCTACTTGGGCGTCTTTCTCGAGAAAGACGCCCAAGTAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018941.2-1074s1c1
Sequence:CCGGGCTGCGGAAGAAGAGGCCATACTCGAGTATGGCCTCTTCTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018941.2-381s1c1
Sequence:CCGGGAATGCCACTTACCGTTCTTTCTCGAGAAAGAACGGTAAGTGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018941.2-919s1c1
Sequence:CCGGCCTCATTTGACACTGTTCCTTCTCGAGAAGGAACAGTGTCAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018941.3-889s21c1
Sequence:CCGGGGCTGATGATTCACATGTTTCCTCGAGGAAACATGTGAATCATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018941.3-828s21c1
Sequence:CCGGGTTTCCTGGATGCTCTTAAAGCTCGAGCTTTAAGAGCATCCAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018941.3-1318s21c1
Sequence:CCGGTTGAAGTAGCTACAAAGTATTCTCGAGAATACTTTGTAGCTACTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018941.3-679s21c1
Sequence:CCGGACTTGATCTTCCGGACATTTGCTCGAGCAAATGTCCGGAAGATCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018941
VALIDATED
CLN8 MISSION shRNA Lentiviral Transduction Particles
ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018941.2-949s1c1
Sequence:CCGGGCTCTGCTTACGCTAATCATTCTCGAGAATGATTAGCGTAAGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_018941.2-331s1c1
Sequence:CCGGGTCTTCTACTTGGGCGTCTTTCTCGAGAAAGACGCCCAAGTAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_018941.2-1074s1c1
Sequence:CCGGGCTGCGGAAGAAGAGGCCATACTCGAGTATGGCCTCTTCTTCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018941.2-381s1c1
Sequence:CCGGGAATGCCACTTACCGTTCTTTCTCGAGAAAGAACGGTAAGTGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018941.2-919s1c1
Sequence:CCGGCCTCATTTGACACTGTTCCTTCTCGAGAAGGAACAGTGTCAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018941.3-889s21c1
Sequence:CCGGGGCTGATGATTCACATGTTTCCTCGAGGAAACATGTGAATCATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018941.3-828s21c1
Sequence:CCGGGTTTCCTGGATGCTCTTAAAGCTCGAGCTTTAAGAGCATCCAGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018941.3-1318s21c1
Sequence:CCGGTTGAAGTAGCTACAAAGTATTCTCGAGAATACTTTGTAGCTACTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018941.3-679s21c1
Sequence:CCGGACTTGATCTTCCGGACATTTGCTCGAGCAAATGTCCGGAAGATCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks