EMAIL THIS PAGE TO A FRIEND

CLNK

cytokine-dependent hematopoietic cell linker

69 Gene Product Result for
Synonyms: MIST
UniProtKB ID: Q7Z7G1, Q05C27, Q9P2U9
Gene ID:
Human(116449) Summary: MIST is a member of the SLP76 family of adaptors (see LCP2, MIM 601603; BLNK, MIM 604515). MIST plays a role in the regulation of immunoreceptor signaling, including PLC-gamma (PLCG1; MIM 172420)-mediated B cell antigen receptor (BCR) signaling and FC-epsilon R1 (see FCER1A, MIM 147140)-mediated mast cell degranulation (Cao et al., 1999 [PubMed 10562326]
Mouse(27278) cytokine-dependent hematopoietic cell linker
Rat(295518) cytokine-dependent hematopoietic cell linker
dog(488823) cytokine-dependent hematopoietic cell linker
cow(100298588) cytokine-dependent hematopoietic cell linker
domestic cat(101091783) cytokine-dependent hematopoietic cell linker
domestic guinea pig(100733094) cytokine-dependent hematopoietic cell linker
naked mole-rat(101715444) cytokine-dependent hematopoietic cell linker
sheep(101115279) cytokine-dependent hematopoietic cell linker
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052964 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052964 Rosetta Predictions human pricing
XM_227776 Rosetta Predictions rat pricing
NM_013748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011359 predicted 503
2 SASI_Hs01_00011360 predicted 1260
3 SASI_Hs01_00011362 predicted 249
4 SASI_Hs01_00011363 predicted 977
5 SASI_Hs01_00011364 predicted 522
6 SASI_Hs01_00011365 predicted 1223
7 SASI_Hs01_00011366 predicted 960
8 SASI_Hs01_00011367 predicted 940
9 SASI_Hs02_00361768 predicted 1396
10 SASI_Hs02_00361769 predicted 1291
11 SASI_Hs01_00011358 predicted 522
12 SASI_Hs01_00011361 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384704 predicted 1084
2 SASI_Rn02_00384705 predicted 208
3 SASI_Rn02_00384706 predicted 448
4 SASI_Rn02_00384707 predicted 320
5 SASI_Rn02_00384708 predicted 942
6 SASI_Rn02_00384709 predicted 454
7 SASI_Rn02_00384710 predicted 302
8 SASI_Rn02_00384711 predicted 450
9 SASI_Rn02_00384712 predicted 307
10 SASI_Rn02_00384713 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126719 predicted 1085
2 SASI_Mm01_00126720 predicted 968
3 SASI_Mm02_00322691 predicted 1187
4 SASI_Mm02_00322692 predicted 316
5 SASI_Mm02_00322693 predicted 431
6 SASI_Mm01_00126722 predicted 1050
7 SASI_Mm01_00126724 predicted 560
8 SASI_Mm01_00126726 predicted 1289
9 SASI_Mm02_00322694 predicted 566
10 SASI_Mm01_00126727 predicted 643
11 SASI_Mm01_00126721 predicted 557
12 SASI_Mm01_00126723 predicted 1445
13 SASI_Mm01_00126725 predicted 1020
14 SASI_Mm01_00126728 predicted 1420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052964
CLNK MISSION shRNA Bacterial Glycerol Stock
cytokine-dependent hematopoietic cell linker
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052964.2-220s21c1
Sequence:CCGGGGTCATGGCCTCGCATCAATACTCGAGTATTGATGCGAGGCCATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052964.2-1127s21c1
Sequence:CCGGTAGTTTCTTGGTCCGAGATTGCTCGAGCAATCTCGGACCAAGAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052964.2-742s21c1
Sequence:CCGGAGATAAGCTTAAGGGACTTAACTCGAGTTAAGTCCCTTAAGCTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-505s1c1
Sequence:CCGGCGGCCTATAAAGGAATCTGAACTCGAGTTCAGATTCCTTTATAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-909s1c1
Sequence:CCGGGCCTGAATCAACTCATCTGTTCTCGAGAACAGATGAGTTGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-732s1c1
Sequence:CCGGGCCTCTCATAACACTTCCGAACTCGAGTTCGGAAGTGTTATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-968s1c1
Sequence:CCGGGCAGTTCTTCATTCACGACAACTCGAGTTGTCGTGAATGAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-297s1c1
Sequence:CCGGCCAGAACTTCAGTCTGCCAAACTCGAGTTTGGCAGACTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052964
CLNK MISSION shRNA shRNA Plasmid DNA
cytokine-dependent hematopoietic cell linker
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052964.2-220s21c1
Sequence:CCGGGGTCATGGCCTCGCATCAATACTCGAGTATTGATGCGAGGCCATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052964.2-1127s21c1
Sequence:CCGGTAGTTTCTTGGTCCGAGATTGCTCGAGCAATCTCGGACCAAGAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052964.2-742s21c1
Sequence:CCGGAGATAAGCTTAAGGGACTTAACTCGAGTTAAGTCCCTTAAGCTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-505s1c1
Sequence:CCGGCGGCCTATAAAGGAATCTGAACTCGAGTTCAGATTCCTTTATAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-909s1c1
Sequence:CCGGGCCTGAATCAACTCATCTGTTCTCGAGAACAGATGAGTTGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-732s1c1
Sequence:CCGGGCCTCTCATAACACTTCCGAACTCGAGTTCGGAAGTGTTATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-968s1c1
Sequence:CCGGGCAGTTCTTCATTCACGACAACTCGAGTTGTCGTGAATGAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-297s1c1
Sequence:CCGGCCAGAACTTCAGTCTGCCAAACTCGAGTTTGGCAGACTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052964
CLNK MISSION shRNA Lentiviral Transduction Particles
cytokine-dependent hematopoietic cell linker
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052964.2-220s21c1
Sequence:CCGGGGTCATGGCCTCGCATCAATACTCGAGTATTGATGCGAGGCCATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052964.2-1127s21c1
Sequence:CCGGTAGTTTCTTGGTCCGAGATTGCTCGAGCAATCTCGGACCAAGAAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052964.2-742s21c1
Sequence:CCGGAGATAAGCTTAAGGGACTTAACTCGAGTTAAGTCCCTTAAGCTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-505s1c1
Sequence:CCGGCGGCCTATAAAGGAATCTGAACTCGAGTTCAGATTCCTTTATAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-909s1c1
Sequence:CCGGGCCTGAATCAACTCATCTGTTCTCGAGAACAGATGAGTTGATTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-732s1c1
Sequence:CCGGGCCTCTCATAACACTTCCGAACTCGAGTTCGGAAGTGTTATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-968s1c1
Sequence:CCGGGCAGTTCTTCATTCACGACAACTCGAGTTGTCGTGAATGAAGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052964.1-297s1c1
Sequence:CCGGCCAGAACTTCAGTCTGCCAAACTCGAGTTTGGCAGACTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013748
CLNK MISSION shRNA Bacterial Glycerol Stock
cytokine-dependent hematopoietic cell linker
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-560s21c1
Sequence:CCGGTGTCAGAAGCCAACGCTTTAACTCGAGTTAAAGCGTTGGCTTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-419s21c1
Sequence:CCGGATACGCAGATACACGCTATTTCTCGAGAAATAGCGTGTATCTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-1298s21c1
Sequence:CCGGCATTGAACACTACACATATTTCTCGAGAAATATGTGTAGTGTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-1251s21c1
Sequence:CCGGGGCACAGGACTACGAGGAAATCTCGAGATTTCCTCGTAGTCCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-1055s21c1
Sequence:CCGGTGAATGGTACATTGGAGAATACTCGAGTATTCTCCAATGTACCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013748.2-688s1c1
Sequence:CCGGGCCAACGCTTTAAAGGATTCACTCGAGTGAATCCTTTAAAGCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013748.2-455s1c1
Sequence:CCGGCGACTACGAAGATCCTGAGTTCTCGAGAACTCAGGATCTTCGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013748
CLNK MISSION shRNA shRNA Plasmid DNA
cytokine-dependent hematopoietic cell linker
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-560s21c1
Sequence:CCGGTGTCAGAAGCCAACGCTTTAACTCGAGTTAAAGCGTTGGCTTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-419s21c1
Sequence:CCGGATACGCAGATACACGCTATTTCTCGAGAAATAGCGTGTATCTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-1298s21c1
Sequence:CCGGCATTGAACACTACACATATTTCTCGAGAAATATGTGTAGTGTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-1251s21c1
Sequence:CCGGGGCACAGGACTACGAGGAAATCTCGAGATTTCCTCGTAGTCCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-1055s21c1
Sequence:CCGGTGAATGGTACATTGGAGAATACTCGAGTATTCTCCAATGTACCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013748.2-688s1c1
Sequence:CCGGGCCAACGCTTTAAAGGATTCACTCGAGTGAATCCTTTAAAGCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013748.2-455s1c1
Sequence:CCGGCGACTACGAAGATCCTGAGTTCTCGAGAACTCAGGATCTTCGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013748
CLNK MISSION shRNA Lentiviral Transduction Particles
cytokine-dependent hematopoietic cell linker
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-560s21c1
Sequence:CCGGTGTCAGAAGCCAACGCTTTAACTCGAGTTAAAGCGTTGGCTTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-419s21c1
Sequence:CCGGATACGCAGATACACGCTATTTCTCGAGAAATAGCGTGTATCTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-1298s21c1
Sequence:CCGGCATTGAACACTACACATATTTCTCGAGAAATATGTGTAGTGTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-1251s21c1
Sequence:CCGGGGCACAGGACTACGAGGAAATCTCGAGATTTCCTCGTAGTCCTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013748.3-1055s21c1
Sequence:CCGGTGAATGGTACATTGGAGAATACTCGAGTATTCTCCAATGTACCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013748.2-688s1c1
Sequence:CCGGGCCAACGCTTTAAAGGATTCACTCGAGTGAATCCTTTAAAGCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013748.2-455s1c1
Sequence:CCGGCGACTACGAAGATCCTGAGTTCTCGAGAACTCAGGATCTTCGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks