EMAIL THIS PAGE TO A FRIEND

CLNS1A

chloride channel, nucleotide-sensitive, 1A

57 Gene Product Result for
Synonyms: CLCI CLNS1B ICln
UniProtKB ID: P54105, B2RCS9, Q0VDK6, Q9NRD2, Q9NRD3
Gene ID:
Human(1207) Summary: This gene encodes a protein that functions in multiple regulatory pathways. The encoded protein complexes with numerous cytosolic proteins and performs diverse functions including regulation of small nuclear ribonucleoprotein biosynthesis, platelet activation and cytoskeletal organization. The protein is also found associated with the plasma membrane where it functions as a chloride current regulator. Pseudogenes of this gene are found on chromosomes 1, 4 and 6. [provided by RefSeq, Feb 2009]
Mouse(12729) chloride channel, nucleotide-sensitive, 1A
Rat(65160) chloride channel, nucleotide-sensitive, 1A
Goat(100861369) chloride channel, nucleotide-sensitive, 1A
sheep(101111236) chloride channel, nucleotide-sensitive, 1A
Domestic Rabbit(100008991) chloride channel, nucleotide-sensitive, 1A
naked mole-rat(101714740) chloride channel, nucleotide-sensitive, 1A
domestic guinea pig(100714108) chloride channel, nucleotide-sensitive, 1A
chicken(425500) chloride channel, nucleotide-sensitive, 1A
dog(403971) chloride channel, nucleotide-sensitive, 1A
cow(613968) chloride channel, nucleotide-sensitive, 1A
domestic cat(101081921) chloride channel, nucleotide-sensitive, 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001293 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001293 Rosetta Predictions human pricing
NM_031719 Rosetta Predictions rat pricing
NM_023671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235286 predicted 702
2 SASI_Hs01_00235288 predicted 402
3 SASI_Hs01_00235289 predicted 386
4 SASI_Hs01_00235290 predicted 783
5 SASI_Hs01_00235291 predicted 262
6 SASI_Hs01_00235292 predicted 824
7 SASI_Hs01_00235293 predicted 842
8 SASI_Hs01_00235294 predicted 411
9 SASI_Hs01_00235295 predicted 512
10 SASI_Hs02_00331553 predicted 333
11 SASI_Hs01_00235287 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111181 predicted 358
2 SASI_Rn01_00111182 predicted 790
3 SASI_Rn01_00111183 predicted 768
4 SASI_Rn01_00111184 predicted 451
5 SASI_Rn01_00111185 predicted 239
6 SASI_Rn01_00111186 predicted 359
7 SASI_Rn01_00111187 predicted 758
8 SASI_Rn01_00111188 predicted 540
9 SASI_Rn01_00111189 predicted 775
10 SASI_Rn01_00111190 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123232 predicted 932
2 SASI_Mm01_00123239 predicted 599
3 SASI_Mm01_00123234 predicted 870
4 SASI_Mm01_00123235 predicted 273
5 SASI_Mm01_00123236 predicted 926
6 SASI_Mm02_00327291 predicted 715
7 SASI_Mm01_00123237 predicted 379
8 SASI_Mm01_00123238 predicted 364
9 SASI_Mm01_00123233 predicted 965
10 SASI_Mm01_00123240 predicted 282
11 SASI_Mm01_00123241 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023671
VALIDATED
CLNS1A MISSION shRNA Bacterial Glycerol Stock
chloride channel, nucleotide-sensitive, 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-206s1c1
Sequence:CCGGGATTAGGATTCTCACTGGAATCTCGAGATTCCAGTGAGAATCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-396s1c1
Sequence:CCGGGCCCAGTGATAAGTCAGCATTCTCGAGAATGCTGACTTATCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-274s1c1
Sequence:CCGGCCTCAAGAGCATTTGTATGTTCTCGAGAACATACAAATGCTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023671.1-645s1c1
Sequence:CCGGCCAATATAATATGGCAGGCGTCTCGAGACGCCTGCCATATTATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-189s1c1
Sequence:CCGGCTGGTTAGATGGTTCGGGATTCTCGAGAATCCCGAACCATCTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023671
VALIDATED
CLNS1A MISSION shRNA shRNA Plasmid DNA
chloride channel, nucleotide-sensitive, 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-206s1c1
Sequence:CCGGGATTAGGATTCTCACTGGAATCTCGAGATTCCAGTGAGAATCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-396s1c1
Sequence:CCGGGCCCAGTGATAAGTCAGCATTCTCGAGAATGCTGACTTATCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-274s1c1
Sequence:CCGGCCTCAAGAGCATTTGTATGTTCTCGAGAACATACAAATGCTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023671.1-645s1c1
Sequence:CCGGCCAATATAATATGGCAGGCGTCTCGAGACGCCTGCCATATTATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-189s1c1
Sequence:CCGGCTGGTTAGATGGTTCGGGATTCTCGAGAATCCCGAACCATCTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023671
VALIDATED
CLNS1A MISSION shRNA Lentiviral Transduction Particles
chloride channel, nucleotide-sensitive, 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-206s1c1
Sequence:CCGGGATTAGGATTCTCACTGGAATCTCGAGATTCCAGTGAGAATCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-396s1c1
Sequence:CCGGGCCCAGTGATAAGTCAGCATTCTCGAGAATGCTGACTTATCACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-274s1c1
Sequence:CCGGCCTCAAGAGCATTTGTATGTTCTCGAGAACATACAAATGCTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023671.1-645s1c1
Sequence:CCGGCCAATATAATATGGCAGGCGTCTCGAGACGCCTGCCATATTATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023671.1-189s1c1
Sequence:CCGGCTGGTTAGATGGTTCGGGATTCTCGAGAATCCCGAACCATCTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001293
VALIDATED
CLNS1A MISSION shRNA Bacterial Glycerol Stock
chloride channel, nucleotide-sensitive, 1A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001293.1-1070s1c1
Sequence:CCGGCCCTCTGAGTAGGCCTATAATCTCGAGATTATAGGCCTACTCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001293.1-316s1c1
Sequence:CCGGGCATTTGTATGTTATGGTGAACTCGAGTTCACCATAACATACAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001293.1-758s1c1
Sequence:CCGGCCAACAGTTGCTGGACAGTTTCTCGAGAAACTGTCCAGCAACTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001293.1-433s1c1
Sequence:CCGGGCCTAGTGATAAATCAGCGTTCTCGAGAACGCTGATTTATCACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001293.1-635s1c1
Sequence:CCGGGCCACACTGGAGAGATTAGAACTCGAGTTCTAATCTCTCCAGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-400s21c1
Sequence:CCGGATGATGATGTTGAACCTATTACTCGAGTAATAGGTTCAACATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-639s21c1
Sequence:CCGGGCCACACTGGAGAGATTAGAACTCGAGTTCTAATCTCTCCAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-596s21c1
Sequence:CCGGCACCTATGAAGAAGGATTATCCTCGAGGATAATCCTTCTTCATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-762s21c1
Sequence:CCGGCCAACAGTTGCTGGACAGTTTCTCGAGAAACTGTCCAGCAACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001293
VALIDATED
CLNS1A MISSION shRNA shRNA Plasmid DNA
chloride channel, nucleotide-sensitive, 1A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001293.1-1070s1c1
Sequence:CCGGCCCTCTGAGTAGGCCTATAATCTCGAGATTATAGGCCTACTCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001293.1-316s1c1
Sequence:CCGGGCATTTGTATGTTATGGTGAACTCGAGTTCACCATAACATACAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001293.1-758s1c1
Sequence:CCGGCCAACAGTTGCTGGACAGTTTCTCGAGAAACTGTCCAGCAACTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001293.1-433s1c1
Sequence:CCGGGCCTAGTGATAAATCAGCGTTCTCGAGAACGCTGATTTATCACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001293.1-635s1c1
Sequence:CCGGGCCACACTGGAGAGATTAGAACTCGAGTTCTAATCTCTCCAGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-400s21c1
Sequence:CCGGATGATGATGTTGAACCTATTACTCGAGTAATAGGTTCAACATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-639s21c1
Sequence:CCGGGCCACACTGGAGAGATTAGAACTCGAGTTCTAATCTCTCCAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-596s21c1
Sequence:CCGGCACCTATGAAGAAGGATTATCCTCGAGGATAATCCTTCTTCATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-762s21c1
Sequence:CCGGCCAACAGTTGCTGGACAGTTTCTCGAGAAACTGTCCAGCAACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001293
VALIDATED
CLNS1A MISSION shRNA Lentiviral Transduction Particles
chloride channel, nucleotide-sensitive, 1A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001293.1-1070s1c1
Sequence:CCGGCCCTCTGAGTAGGCCTATAATCTCGAGATTATAGGCCTACTCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001293.1-316s1c1
Sequence:CCGGGCATTTGTATGTTATGGTGAACTCGAGTTCACCATAACATACAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001293.1-758s1c1
Sequence:CCGGCCAACAGTTGCTGGACAGTTTCTCGAGAAACTGTCCAGCAACTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001293.1-433s1c1
Sequence:CCGGGCCTAGTGATAAATCAGCGTTCTCGAGAACGCTGATTTATCACTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001293.1-635s1c1
Sequence:CCGGGCCACACTGGAGAGATTAGAACTCGAGTTCTAATCTCTCCAGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-400s21c1
Sequence:CCGGATGATGATGTTGAACCTATTACTCGAGTAATAGGTTCAACATCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-639s21c1
Sequence:CCGGGCCACACTGGAGAGATTAGAACTCGAGTTCTAATCTCTCCAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-596s21c1
Sequence:CCGGCACCTATGAAGAAGGATTATCCTCGAGGATAATCCTTCTTCATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001293.2-762s21c1
Sequence:CCGGCCAACAGTTGCTGGACAGTTTCTCGAGAAACTGTCCAGCAACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks