EMAIL THIS PAGE TO A FRIEND

CLOCK

clock circadian regulator

181 Gene Product Result for
Synonyms: KAT13D bHLHe8
UniProtKB ID: O15516, A0AV01, A2I2N9, O14516, Q9UIT8
Gene ID:
Human(9575) Summary: This gene product regulates circadian rhythm and metabolism. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and a DNA binding histone acetyltransferase. Polymorphisms in this gene may be associated with behavioral changes in certain populations and with obesity and metabolic syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Mouse(12753) circadian locomotor output cycles kaput
Rat(60447) clock circadian regulator
cow(786637) clock homolog (mouse)
cow(100300400) clock homolog (mouse)
Horse(100034166) clock homolog (mouse)
domestic cat(101088483) clock homolog (mouse)
dog(475145) clock homolog (mouse)
chicken(373991) clock homolog (mouse)
sheep(100171391) clock homolog (mouse)
Domestic Rabbit(100349684) clock homolog (mouse)
domestic guinea pig(100728432) clock circadian regulator
naked mole-rat(101725536) clock circadian regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004898 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004898 Rosetta Predictions human pricing
NM_021856 Rosetta Predictions rat pricing
NM_007715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039481 predicted 1306
2 SASI_Hs01_00039482 predicted 952
3 SASI_Hs01_00039483 predicted 2185
4 SASI_Hs02_00338545 predicted 361
5 SASI_Hs01_00039484 predicted 2203
6 SASI_Hs01_00039485 predicted 2221
7 SASI_Hs01_00039486 predicted 2316
8 SASI_Hs01_00039488 predicted 1317
9 SASI_Hs01_00039489 predicted 1686
10 SASI_Hs01_00039490 predicted 2142
11 SASI_Hs01_00039487 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082175 predicted 785
2 SASI_Rn01_00082177 predicted 1717
3 SASI_Rn01_00082178 predicted 835
4 SASI_Rn01_00082179 predicted 1601
5 SASI_Rn01_00082180 predicted 1122
6 SASI_Rn02_00262883 predicted 1485
7 SASI_Rn01_00082181 predicted 1763
8 SASI_Rn01_00082182 predicted 679
9 SASI_Rn01_00082183 predicted 1115
10 SASI_Rn01_00082184 predicted 1866
11 SASI_Rn01_00082176 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082135 predicted 1175
2 SASI_Mm01_00082137 predicted 1221
3 SASI_Mm01_00082138 predicted 1508
4 SASI_Mm01_00082139 predicted 1211
5 SASI_Mm01_00082140 predicted 2089
6 SASI_Mm02_00312283 predicted 2151
7 SASI_Mm02_00312284 predicted 1779
8 SASI_Mm02_00312285 predicted 1831
9 SASI_Mm01_00082142 predicted 1064
10 SASI_Mm01_00082143 predicted 1483
11 SASI_Mm01_00082136 predicted 1062
12 SASI_Mm01_00082141 predicted 1597
13 SASI_Mm01_00082144 predicted 2253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007715
VALIDATED
CLOCK MISSION shRNA Bacterial Glycerol Stock
clock circadian regulator
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-1989s21c1
Sequence:CCGGCACGGATGATAGAGGCAAATACTCGAGTATTTGCCTCTATCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007715.5-1303s21c1
Sequence:CCGGGGGAACATCAGGCTATGATTACTCGAGTAATCATAGCCTGATGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-3103s21c1
Sequence:CCGGGTGCTTCAGATGTCCATTAAACTCGAGTTTAATGGACATCTGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-2465s21c1
Sequence:CCGGCAGGACAGACAGATAAGATTTCTCGAGAAATCTTATCTGTCTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-1825s21c1
Sequence:CCGGCTTCAGCAGTCAGTCCATAAACTCGAGTTTATGGACTGACTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007715.4-6762s1c1
Sequence:CCGGCCACAGTTTAAGAGCATCATTCTCGAGAATGATGCTCTTAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007715.4-1265s1c1
Sequence:CCGGGCACCACCAATAATAGGCTATCTCGAGATAGCCTATTATTGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007715.4-1989s1c1
Sequence:CCGGCACGGATGATAGAGGCAAATACTCGAGTATTTGCCTCTATCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007715.4-870s1c1
Sequence:CCGGGAGAACATTCAGAGGTTTATACTCGAGTATAAACCTCTGAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007715.4-1991s1c1
Sequence:CCGGCGGATGATAGAGGCAAATATTCTCGAGAATATTTGCCTCTATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007715
VALIDATED
CLOCK MISSION shRNA shRNA Plasmid DNA
clock circadian regulator
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-1989s21c1
Sequence:CCGGCACGGATGATAGAGGCAAATACTCGAGTATTTGCCTCTATCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007715.5-1303s21c1
Sequence:CCGGGGGAACATCAGGCTATGATTACTCGAGTAATCATAGCCTGATGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-3103s21c1
Sequence:CCGGGTGCTTCAGATGTCCATTAAACTCGAGTTTAATGGACATCTGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-2465s21c1
Sequence:CCGGCAGGACAGACAGATAAGATTTCTCGAGAAATCTTATCTGTCTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-1825s21c1
Sequence:CCGGCTTCAGCAGTCAGTCCATAAACTCGAGTTTATGGACTGACTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007715.4-6762s1c1
Sequence:CCGGCCACAGTTTAAGAGCATCATTCTCGAGAATGATGCTCTTAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007715.4-1265s1c1
Sequence:CCGGGCACCACCAATAATAGGCTATCTCGAGATAGCCTATTATTGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007715.4-1989s1c1
Sequence:CCGGCACGGATGATAGAGGCAAATACTCGAGTATTTGCCTCTATCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007715.4-870s1c1
Sequence:CCGGGAGAACATTCAGAGGTTTATACTCGAGTATAAACCTCTGAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007715.4-1991s1c1
Sequence:CCGGCGGATGATAGAGGCAAATATTCTCGAGAATATTTGCCTCTATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007715
VALIDATED
CLOCK MISSION shRNA Lentiviral Transduction Particles
clock circadian regulator
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-1989s21c1
Sequence:CCGGCACGGATGATAGAGGCAAATACTCGAGTATTTGCCTCTATCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007715.5-1303s21c1
Sequence:CCGGGGGAACATCAGGCTATGATTACTCGAGTAATCATAGCCTGATGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-3103s21c1
Sequence:CCGGGTGCTTCAGATGTCCATTAAACTCGAGTTTAATGGACATCTGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-2465s21c1
Sequence:CCGGCAGGACAGACAGATAAGATTTCTCGAGAAATCTTATCTGTCTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007715.5-1825s21c1
Sequence:CCGGCTTCAGCAGTCAGTCCATAAACTCGAGTTTATGGACTGACTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007715.4-6762s1c1
Sequence:CCGGCCACAGTTTAAGAGCATCATTCTCGAGAATGATGCTCTTAAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007715.4-1265s1c1
Sequence:CCGGGCACCACCAATAATAGGCTATCTCGAGATAGCCTATTATTGGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007715.4-1989s1c1
Sequence:CCGGCACGGATGATAGAGGCAAATACTCGAGTATTTGCCTCTATCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007715.4-870s1c1
Sequence:CCGGGAGAACATTCAGAGGTTTATACTCGAGTATAAACCTCTGAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007715.4-1991s1c1
Sequence:CCGGCGGATGATAGAGGCAAATATTCTCGAGAATATTTGCCTCTATCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004898
VALIDATED
CLOCK MISSION shRNA Bacterial Glycerol Stock
clock circadian regulator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-2072s21c1
Sequence:CCGGCGTTCAACTTTCTTCTGGAAACTCGAGTTTCCAGAAGAAAGTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-932s21c1
Sequence:CCGGGCGAGGAACAATAGACCCAAACTCGAGTTTGGGTCTATTGTTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-1053s21c1
Sequence:CCGGCGCACACATAGGCCATCTTATCTCGAGATAAGATGGCCTATGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-1546s21c1
Sequence:CCGGGCCAAGATTCTGGGTCAGATACTCGAGTATCTGACCCAGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-1494s21c1
Sequence:CCGGCGACGAGAACTTGGCATTGAACTCGAGTTCAATGCCAAGTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-1546s1c1
Sequence:CCGGGCCAAGATTCTGGGTCAGATACTCGAGTATCTGACCCAGAATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-1053s1c1
Sequence:CCGGCGCACACATAGGCCATCTTATCTCGAGATAAGATGGCCTATGTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-2072s1c1
Sequence:CCGGCGTTCAACTTTCTTCTGGAAACTCGAGTTTCCAGAAGAAAGTTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-932s1c1
Sequence:CCGGGCGAGGAACAATAGACCCAAACTCGAGTTTGGGTCTATTGTTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-1494s1c1
Sequence:CCGGCGACGAGAACTTGGCATTGAACTCGAGTTCAATGCCAAGTTCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004898
VALIDATED
CLOCK MISSION shRNA shRNA Plasmid DNA
clock circadian regulator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-2072s21c1
Sequence:CCGGCGTTCAACTTTCTTCTGGAAACTCGAGTTTCCAGAAGAAAGTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-932s21c1
Sequence:CCGGGCGAGGAACAATAGACCCAAACTCGAGTTTGGGTCTATTGTTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-1053s21c1
Sequence:CCGGCGCACACATAGGCCATCTTATCTCGAGATAAGATGGCCTATGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-1546s21c1
Sequence:CCGGGCCAAGATTCTGGGTCAGATACTCGAGTATCTGACCCAGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-1494s21c1
Sequence:CCGGCGACGAGAACTTGGCATTGAACTCGAGTTCAATGCCAAGTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-1546s1c1
Sequence:CCGGGCCAAGATTCTGGGTCAGATACTCGAGTATCTGACCCAGAATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-1053s1c1
Sequence:CCGGCGCACACATAGGCCATCTTATCTCGAGATAAGATGGCCTATGTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-2072s1c1
Sequence:CCGGCGTTCAACTTTCTTCTGGAAACTCGAGTTTCCAGAAGAAAGTTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-932s1c1
Sequence:CCGGGCGAGGAACAATAGACCCAAACTCGAGTTTGGGTCTATTGTTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-1494s1c1
Sequence:CCGGCGACGAGAACTTGGCATTGAACTCGAGTTCAATGCCAAGTTCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004898
VALIDATED
CLOCK MISSION shRNA Lentiviral Transduction Particles
clock circadian regulator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-2072s21c1
Sequence:CCGGCGTTCAACTTTCTTCTGGAAACTCGAGTTTCCAGAAGAAAGTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-932s21c1
Sequence:CCGGGCGAGGAACAATAGACCCAAACTCGAGTTTGGGTCTATTGTTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-1053s21c1
Sequence:CCGGCGCACACATAGGCCATCTTATCTCGAGATAAGATGGCCTATGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-1546s21c1
Sequence:CCGGGCCAAGATTCTGGGTCAGATACTCGAGTATCTGACCCAGAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004898.2-1494s21c1
Sequence:CCGGCGACGAGAACTTGGCATTGAACTCGAGTTCAATGCCAAGTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-1546s1c1
Sequence:CCGGGCCAAGATTCTGGGTCAGATACTCGAGTATCTGACCCAGAATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-1053s1c1
Sequence:CCGGCGCACACATAGGCCATCTTATCTCGAGATAAGATGGCCTATGTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-2072s1c1
Sequence:CCGGCGTTCAACTTTCTTCTGGAAACTCGAGTTTCCAGAAGAAAGTTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-932s1c1
Sequence:CCGGGCGAGGAACAATAGACCCAAACTCGAGTTTGGGTCTATTGTTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004898.2-1494s1c1
Sequence:CCGGCGACGAGAACTTGGCATTGAACTCGAGTTCAATGCCAAGTTCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks