EMAIL THIS PAGE TO A FRIEND

CLP1

cleavage and polyadenylation factor I subunit 1

58 Gene Product Result for
Synonyms: HEAB hClp1
UniProtKB ID: Q92989, B2R7J6, B4DTI8
Gene ID:
Mouse(98985) CLP1, cleavage and polyadenylation factor I subunit
Rat(311166) cleavage and polyadenylation factor I subunit 1
Zebrafish(327098) CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)
dog(610161) cleavage and polyadenylation factor I subunit 1
Horse(100066955) cleavage and polyadenylation factor I subunit 1
cow(506507) CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)
domestic cat(101091047) cleavage and polyadenylation factor I subunit 1
chicken(423131) CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)
naked mole-rat(101723956) cleavage and polyadenylation factor I subunit 1
domestic guinea pig(100721583) cleavage and polyadenylation factor I subunit 1
sheep(101106031) cleavage and polyadenylation factor I subunit 1
Domestic Rabbit(100350312) cleavage and polyadenylation factor I subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006831 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006831 Rosetta Predictions human pricing
NM_001009599 Rosetta Predictions rat pricing
NM_133840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138994 predicted 963
2 SASI_Hs01_00138995 predicted 809
3 SASI_Hs01_00138996 predicted 980
4 SASI_Hs01_00138997 predicted 1300
5 SASI_Hs01_00138998 predicted 1598
6 SASI_Hs02_00342392 predicted 1479
7 SASI_Hs02_00342393 predicted 720
8 SASI_Hs01_00138999 predicted 1978
9 SASI_Hs02_00342394 predicted 1154
10 SASI_Hs01_00139002 predicted 751
11 SASI_Hs01_00139000 predicted 1737
12 SASI_Hs01_00139001 predicted 1504
13 SASI_Hs01_00139003 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075521 predicted 986
2 SASI_Rn01_00075522 predicted 389
3 SASI_Rn01_00075523 predicted 1478
4 SASI_Rn02_00199607 predicted 370
5 SASI_Rn01_00075525 predicted 341
6 SASI_Rn01_00075526 predicted 1451
7 SASI_Rn01_00075527 predicted 981
8 SASI_Rn01_00075528 predicted 680
9 SASI_Rn01_00075529 predicted 1366
10 SASI_Rn02_00199608 predicted 708
11 SASI_Rn01_00075520 predicted 886
12 SASI_Rn01_00075524 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338880 predicted 1013
2 SASI_Mm01_00112706 predicted 1042
3 SASI_Mm02_00338881 predicted 410
4 SASI_Mm01_00112711 predicted 216
5 SASI_Mm01_00112712 predicted 1464
6 SASI_Mm01_00112713 predicted 1115
7 SASI_Mm02_00338882 predicted 1008
8 SASI_Mm01_00112714 predicted 371
9 SASI_Mm02_00338883 predicted 389
10 SASI_Mm01_00112715 predicted 1382
11 SASI_Mm01_00112707 predicted 1012
12 SASI_Mm01_00112708 predicted 1036
13 SASI_Mm01_00112709 predicted 1023
14 SASI_Mm01_00112710 predicted 868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133840
VALIDATED
CLP1 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation factor I subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133840.1-1560s1c1
Sequence:CCGGCCTGGCTATTATTTGGTTCATCTCGAGATGAACCAAATAATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133840.1-1031s1c1
Sequence:CCGGCCGTGAGTATTTCTATGGATTCTCGAGAATCCATAGAAATACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133840.1-159s1c1
Sequence:CCGGCCAACGACTAAGTTTGAACTACTCGAGTAGTTCAAACTTAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133840.1-558s1c1
Sequence:CCGGCGTCCTACTTACGTGGAGTTACTCGAGTAACTCCACGTAAGTAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133840.1-1032s1c1
Sequence:CCGGCGTGAGTATTTCTATGGATTTCTCGAGAAATCCATAGAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-159s21c1
Sequence:CCGGCCAACGACTAAGTTTGAACTACTCGAGTAGTTCAAACTTAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133840.2-1032s21c1
Sequence:CCGGCGTGAGTATTTCTATGGATTTCTCGAGAAATCCATAGAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-1392s21c1
Sequence:CCGGATGGATCTCAAGTAGTAATTGCTCGAGCAATTACTACTTGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-1470s21c1
Sequence:CCGGTGGACTATAGCAATCTTATTACTCGAGTAATAAGATTGCTATAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-906s21c1
Sequence:CCGGGAGCGACTGTACAACGAATTGCTCGAGCAATTCGTTGTACAGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133840
VALIDATED
CLP1 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation factor I subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133840.1-1560s1c1
Sequence:CCGGCCTGGCTATTATTTGGTTCATCTCGAGATGAACCAAATAATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133840.1-1031s1c1
Sequence:CCGGCCGTGAGTATTTCTATGGATTCTCGAGAATCCATAGAAATACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133840.1-159s1c1
Sequence:CCGGCCAACGACTAAGTTTGAACTACTCGAGTAGTTCAAACTTAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133840.1-558s1c1
Sequence:CCGGCGTCCTACTTACGTGGAGTTACTCGAGTAACTCCACGTAAGTAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133840.1-1032s1c1
Sequence:CCGGCGTGAGTATTTCTATGGATTTCTCGAGAAATCCATAGAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-159s21c1
Sequence:CCGGCCAACGACTAAGTTTGAACTACTCGAGTAGTTCAAACTTAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133840.2-1032s21c1
Sequence:CCGGCGTGAGTATTTCTATGGATTTCTCGAGAAATCCATAGAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-1392s21c1
Sequence:CCGGATGGATCTCAAGTAGTAATTGCTCGAGCAATTACTACTTGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-1470s21c1
Sequence:CCGGTGGACTATAGCAATCTTATTACTCGAGTAATAAGATTGCTATAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-906s21c1
Sequence:CCGGGAGCGACTGTACAACGAATTGCTCGAGCAATTCGTTGTACAGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133840
VALIDATED
CLP1 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation factor I subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133840.1-1560s1c1
Sequence:CCGGCCTGGCTATTATTTGGTTCATCTCGAGATGAACCAAATAATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133840.1-1031s1c1
Sequence:CCGGCCGTGAGTATTTCTATGGATTCTCGAGAATCCATAGAAATACTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133840.1-159s1c1
Sequence:CCGGCCAACGACTAAGTTTGAACTACTCGAGTAGTTCAAACTTAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133840.1-558s1c1
Sequence:CCGGCGTCCTACTTACGTGGAGTTACTCGAGTAACTCCACGTAAGTAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133840.1-1032s1c1
Sequence:CCGGCGTGAGTATTTCTATGGATTTCTCGAGAAATCCATAGAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-159s21c1
Sequence:CCGGCCAACGACTAAGTTTGAACTACTCGAGTAGTTCAAACTTAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133840.2-1032s21c1
Sequence:CCGGCGTGAGTATTTCTATGGATTTCTCGAGAAATCCATAGAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-1392s21c1
Sequence:CCGGATGGATCTCAAGTAGTAATTGCTCGAGCAATTACTACTTGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-1470s21c1
Sequence:CCGGTGGACTATAGCAATCTTATTACTCGAGTAATAAGATTGCTATAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133840.2-906s21c1
Sequence:CCGGGAGCGACTGTACAACGAATTGCTCGAGCAATTCGTTGTACAGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006831
VALIDATED
CLP1 MISSION shRNA Bacterial Glycerol Stock
cleavage and polyadenylation factor I subunit 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006831.1-778s1c1
Sequence:CCGGCGAGAAACAGAACTTCGCTTTCTCGAGAAAGCGAAGTTCTGTTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006831.1-867s1c1
Sequence:CCGGGCTGACCCGAAACAAGAAATTCTCGAGAATTTCTTGTTTCGGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006831.1-1665s1c1
Sequence:CCGGCCATGCCTTCAATGTCAAATTCTCGAGAATTTGACATTGAAGGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006831.1-1300s1c1
Sequence:CCGGCCTGGCACTAACATCAAGCTTCTCGAGAAGCTTGATGTTAGTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006831.1-1950s1c1
Sequence:CCGGGCCTAAGAACTTCCTTCTCATCTCGAGATGAGAAGGAAGTTCTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-1201s21c1
Sequence:CCGGTGTCACTCCTGGGCGAGATATCTCGAGATATCTCGCCCAGGAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-283s21c1
Sequence:CCGGGCTGACCCGAAACAAGAAATTCTCGAGAATTTCTTGTTTCGGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-1032s21c1
Sequence:CCGGATGAGCGTATCCGTGAGTATTCTCGAGAATACTCACGGATACGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-1568s21c1
Sequence:CCGGTGGTAACCTGACTCTTCTAATCTCGAGATTAGAAGAGTCAGGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-720s21c1
Sequence:CCGGGCACTAACATCAAGCTTTATACTCGAGTATAAAGCTTGATGTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006831
VALIDATED
CLP1 MISSION shRNA shRNA Plasmid DNA
cleavage and polyadenylation factor I subunit 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006831.1-778s1c1
Sequence:CCGGCGAGAAACAGAACTTCGCTTTCTCGAGAAAGCGAAGTTCTGTTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006831.1-867s1c1
Sequence:CCGGGCTGACCCGAAACAAGAAATTCTCGAGAATTTCTTGTTTCGGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006831.1-1665s1c1
Sequence:CCGGCCATGCCTTCAATGTCAAATTCTCGAGAATTTGACATTGAAGGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006831.1-1300s1c1
Sequence:CCGGCCTGGCACTAACATCAAGCTTCTCGAGAAGCTTGATGTTAGTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006831.1-1950s1c1
Sequence:CCGGGCCTAAGAACTTCCTTCTCATCTCGAGATGAGAAGGAAGTTCTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-1201s21c1
Sequence:CCGGTGTCACTCCTGGGCGAGATATCTCGAGATATCTCGCCCAGGAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-283s21c1
Sequence:CCGGGCTGACCCGAAACAAGAAATTCTCGAGAATTTCTTGTTTCGGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-1032s21c1
Sequence:CCGGATGAGCGTATCCGTGAGTATTCTCGAGAATACTCACGGATACGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-1568s21c1
Sequence:CCGGTGGTAACCTGACTCTTCTAATCTCGAGATTAGAAGAGTCAGGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-720s21c1
Sequence:CCGGGCACTAACATCAAGCTTTATACTCGAGTATAAAGCTTGATGTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006831
VALIDATED
CLP1 MISSION shRNA Lentiviral Transduction Particles
cleavage and polyadenylation factor I subunit 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006831.1-778s1c1
Sequence:CCGGCGAGAAACAGAACTTCGCTTTCTCGAGAAAGCGAAGTTCTGTTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006831.1-867s1c1
Sequence:CCGGGCTGACCCGAAACAAGAAATTCTCGAGAATTTCTTGTTTCGGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006831.1-1665s1c1
Sequence:CCGGCCATGCCTTCAATGTCAAATTCTCGAGAATTTGACATTGAAGGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006831.1-1300s1c1
Sequence:CCGGCCTGGCACTAACATCAAGCTTCTCGAGAAGCTTGATGTTAGTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006831.1-1950s1c1
Sequence:CCGGGCCTAAGAACTTCCTTCTCATCTCGAGATGAGAAGGAAGTTCTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-1201s21c1
Sequence:CCGGTGTCACTCCTGGGCGAGATATCTCGAGATATCTCGCCCAGGAGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-283s21c1
Sequence:CCGGGCTGACCCGAAACAAGAAATTCTCGAGAATTTCTTGTTTCGGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-1032s21c1
Sequence:CCGGATGAGCGTATCCGTGAGTATTCTCGAGAATACTCACGGATACGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-1568s21c1
Sequence:CCGGTGGTAACCTGACTCTTCTAATCTCGAGATTAGAAGAGTCAGGTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006831.2-720s21c1
Sequence:CCGGGCACTAACATCAAGCTTTATACTCGAGTATAAAGCTTGATGTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks