EMAIL THIS PAGE TO A FRIEND

CLPB

ClpB caseinolytic peptidase B homolog (E. coli)

71 Gene Product Result for
Synonyms: HSP78 SKD3
Gene ID:
Mouse(20480) ClpB caseinolytic peptidase B
Rat(65041) ClpB caseinolytic peptidase B homolog (E. coli)
dog(476815) ClpB caseinolytic peptidase B homolog (E. coli)
Horse(100065983) ClpB caseinolytic peptidase B homolog (E. coli)
domestic cat(101083619) ClpB caseinolytic peptidase B homolog (E. coli)
cow(520639) ClpB caseinolytic peptidase B homolog (E. coli)
sheep(101121966) ClpB caseinolytic peptidase B homolog (E. coli)
Domestic Rabbit(100341664) ClpB caseinolytic peptidase B homolog (E. coli)
domestic guinea pig(100731903) ClpB caseinolytic peptidase B homolog (E. coli)
naked mole-rat(101697583) ClpB caseinolytic peptidase B homolog (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030813 Rosetta Predictions human pricing
NM_022947 Rosetta Predictions rat pricing
XM_579470 Rosetta Predictions rat pricing
NM_009191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358392 predicted 1227
2 SASI_Hs01_00166516 predicted 1183
3 SASI_Hs01_00166517 predicted 1579
4 SASI_Hs01_00166518 predicted 475
5 SASI_Hs01_00166519 predicted 1668
6 SASI_Hs01_00166521 predicted 663
7 SASI_Hs01_00166522 predicted 1714
8 SASI_Hs01_00166523 predicted 1695
9 SASI_Hs01_00166525 predicted 330
10 SASI_Hs02_00358393 predicted 1065
11 SASI_Hs01_00166520 predicted 1804
12 SASI_Hs01_00166524 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039377 predicted 467
2 SASI_Rn01_00039378 predicted 718
3 SASI_Rn01_00039379 predicted 1285
4 SASI_Rn01_00039380 predicted 645
5 SASI_Rn01_00039381 predicted 1265
6 SASI_Rn01_00039382 predicted 1498
7 SASI_Rn01_00039383 predicted 438
8 SASI_Rn01_00039384 predicted 668
9 SASI_Rn01_00039386 predicted 1547
10 SASI_Rn02_00263675 predicted 1092
11 SASI_Rn01_00039385 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178050 predicted 271
2 SASI_Rn01_00178051 predicted 264
3 SASI_Rn01_00178052 predicted 290
4 SASI_Rn01_00178053 predicted 228
5 SASI_Rn01_00178054 predicted 229
6 SASI_Rn01_00178055 predicted 249
7 SASI_Rn01_00178056 predicted 230
8 SASI_Rn01_00178057 predicted 211
9 SASI_Rn01_00178058 predicted 227
10 SASI_Rn01_00178059 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315564 predicted 984
2 SASI_Mm01_00126620 predicted 1489
3 SASI_Mm01_00126621 predicted 1128
4 SASI_Mm01_00126623 predicted 422
5 SASI_Mm01_00126624 predicted 542
6 SASI_Mm02_00315565 predicted 433
7 SASI_Mm01_00126625 predicted 320
8 SASI_Mm02_00315566 predicted 644
9 SASI_Mm01_00126626 predicted 874
10 SASI_Mm02_00315567 predicted 1809
11 SASI_Mm01_00126619 predicted 523
12 SASI_Mm01_00126622 predicted 1704
13 SASI_Mm01_00126627 predicted 1622
14 SASI_Mm01_00126628 predicted 908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030813
VALIDATED
CLPB MISSION shRNA Bacterial Glycerol Stock
ClpB caseinolytic peptidase B homolog (E. coli)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030813.3-2669s21c1
Sequence:CCGGAGTTCTGCAATTTAGTCTGTACTCGAGTACAGACTAAATTGCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-672s21c1
Sequence:CCGGGAACAGGGAATCCATTCTTTGCTCGAGCAAAGAATGGATTCCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1300s21c1
Sequence:CCGGGACACGAGGTGGCCAAGTTTACTCGAGTAAACTTGGCCACCTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1720s21c1
Sequence:CCGGAGTTTCTGGGACGGATCAATGCTCGAGCATTGATCCGTCCCAGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1681s21c1
Sequence:CCGGTGATTCGCCCTATCCTGAAAGCTCGAGCTTTCAGGATAGGGCGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030813.3-2368s21c1
Sequence:CCGGCCTTTGTTGTGGGCCCATAACCTCGAGGTTATGGGCCCACAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1644s21c1
Sequence:CCGGGACAAGATCACCATCTCAAAGCTCGAGCTTTGAGATGGTGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-514s21c1
Sequence:CCGGCAGAAGGTGCAGATGTCAATGCTCGAGCATTGACATCTGCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1882s21c1
Sequence:CCGGACGGCTACAATGTGCACTATGCTCGAGCATAGTGCACATTGTAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030813.3-2197s21c1
Sequence:CCGGTGCCCTCACCATCCAATAAAGCTCGAGCTTTATTGGATGGTGAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030813.3-1233s1c1
Sequence:CCGGGCCAAATATATGCACAAAGATCTCGAGATCTTTGTGCATATATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_030813.3-1403s1c1
Sequence:CCGGGCTCTTTGATGAAGTAGACAACTCGAGTTGTCTACTTCATCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030813.3-1775s1c1
Sequence:CCGGGCTCATCCAACTCGTCAACAACTCGAGTTGTTGACGAGTTGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_030813.3-1073s1c1
Sequence:CCGGGCGACTAAAGGAGCACATCATCTCGAGATGATGTGCTCCTTTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030813.3-797s1c1
Sequence:CCGGCCGAGAGGATGACTTCAACAACTCGAGTTGTTGAAGTCATCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030813
VALIDATED
CLPB MISSION shRNA shRNA Plasmid DNA
ClpB caseinolytic peptidase B homolog (E. coli)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030813.3-2669s21c1
Sequence:CCGGAGTTCTGCAATTTAGTCTGTACTCGAGTACAGACTAAATTGCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-672s21c1
Sequence:CCGGGAACAGGGAATCCATTCTTTGCTCGAGCAAAGAATGGATTCCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1300s21c1
Sequence:CCGGGACACGAGGTGGCCAAGTTTACTCGAGTAAACTTGGCCACCTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1720s21c1
Sequence:CCGGAGTTTCTGGGACGGATCAATGCTCGAGCATTGATCCGTCCCAGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1681s21c1
Sequence:CCGGTGATTCGCCCTATCCTGAAAGCTCGAGCTTTCAGGATAGGGCGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030813.3-2368s21c1
Sequence:CCGGCCTTTGTTGTGGGCCCATAACCTCGAGGTTATGGGCCCACAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1644s21c1
Sequence:CCGGGACAAGATCACCATCTCAAAGCTCGAGCTTTGAGATGGTGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-514s21c1
Sequence:CCGGCAGAAGGTGCAGATGTCAATGCTCGAGCATTGACATCTGCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1882s21c1
Sequence:CCGGACGGCTACAATGTGCACTATGCTCGAGCATAGTGCACATTGTAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030813.3-2197s21c1
Sequence:CCGGTGCCCTCACCATCCAATAAAGCTCGAGCTTTATTGGATGGTGAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030813.3-1233s1c1
Sequence:CCGGGCCAAATATATGCACAAAGATCTCGAGATCTTTGTGCATATATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_030813.3-1403s1c1
Sequence:CCGGGCTCTTTGATGAAGTAGACAACTCGAGTTGTCTACTTCATCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030813.3-1775s1c1
Sequence:CCGGGCTCATCCAACTCGTCAACAACTCGAGTTGTTGACGAGTTGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_030813.3-1073s1c1
Sequence:CCGGGCGACTAAAGGAGCACATCATCTCGAGATGATGTGCTCCTTTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030813.3-797s1c1
Sequence:CCGGCCGAGAGGATGACTTCAACAACTCGAGTTGTTGAAGTCATCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030813
VALIDATED
CLPB MISSION shRNA Lentiviral Transduction Particles
ClpB caseinolytic peptidase B homolog (E. coli)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030813.3-2669s21c1
Sequence:CCGGAGTTCTGCAATTTAGTCTGTACTCGAGTACAGACTAAATTGCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-672s21c1
Sequence:CCGGGAACAGGGAATCCATTCTTTGCTCGAGCAAAGAATGGATTCCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1300s21c1
Sequence:CCGGGACACGAGGTGGCCAAGTTTACTCGAGTAAACTTGGCCACCTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1720s21c1
Sequence:CCGGAGTTTCTGGGACGGATCAATGCTCGAGCATTGATCCGTCCCAGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1681s21c1
Sequence:CCGGTGATTCGCCCTATCCTGAAAGCTCGAGCTTTCAGGATAGGGCGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030813.3-2368s21c1
Sequence:CCGGCCTTTGTTGTGGGCCCATAACCTCGAGGTTATGGGCCCACAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1644s21c1
Sequence:CCGGGACAAGATCACCATCTCAAAGCTCGAGCTTTGAGATGGTGATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-514s21c1
Sequence:CCGGCAGAAGGTGCAGATGTCAATGCTCGAGCATTGACATCTGCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030813.3-1882s21c1
Sequence:CCGGACGGCTACAATGTGCACTATGCTCGAGCATAGTGCACATTGTAGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030813.3-2197s21c1
Sequence:CCGGTGCCCTCACCATCCAATAAAGCTCGAGCTTTATTGGATGGTGAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030813.3-1233s1c1
Sequence:CCGGGCCAAATATATGCACAAAGATCTCGAGATCTTTGTGCATATATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_030813.3-1403s1c1
Sequence:CCGGGCTCTTTGATGAAGTAGACAACTCGAGTTGTCTACTTCATCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030813.3-1775s1c1
Sequence:CCGGGCTCATCCAACTCGTCAACAACTCGAGTTGTTGACGAGTTGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_030813.3-1073s1c1
Sequence:CCGGGCGACTAAAGGAGCACATCATCTCGAGATGATGTGCTCCTTTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030813.3-797s1c1
Sequence:CCGGCCGAGAGGATGACTTCAACAACTCGAGTTGTTGAAGTCATCCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009191
VALIDATED
CLPB MISSION shRNA Bacterial Glycerol Stock
ClpB caseinolytic peptidase B homolog (E. coli)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-1503s21c1
Sequence:CCGGGCCGAAATCGAATCGCTGAAACTCGAGTTTCAGCGATTCGATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-1800s21c1
Sequence:CCGGACTATGGTGCCCGCTCCATTACTCGAGTAATGGAGCGGGCACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-85s21c1
Sequence:CCGGTCGGCTCTTCCTAGGGTTAATCTCGAGATTAACCCTAGGAAGAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009191.3-2188s21c1
Sequence:CCGGTCTTGGTTGTGAGGTTCATAGCTCGAGCTATGAACCTCACAACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-710s21c1
Sequence:CCGGGACTTCAACAACCGGCTAAATCTCGAGATTTAGCCGGTTGTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009191.2-4265s1c1
Sequence:CCGGGCCCATGTATTCTGTGGTTATCTCGAGATAACCACAGAATACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009191.2-1811s1c1
Sequence:CCGGCGCTCCATTAAGCATGAGGTACTCGAGTACCTCATGCTTAATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009191.2-470s1c1
Sequence:CCGGCGGGCCAATAACGTGCAGGAACTCGAGTTCCTGCACGTTATTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009191.2-1503s1c1
Sequence:CCGGGCCGAAATCGAATCGCTGAAACTCGAGTTTCAGCGATTCGATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009191.2-1136s1c1
Sequence:CCGGGCAAAGTATATGCACAAAGATCTCGAGATCTTTGTGCATATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009191
VALIDATED
CLPB MISSION shRNA shRNA Plasmid DNA
ClpB caseinolytic peptidase B homolog (E. coli)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-1503s21c1
Sequence:CCGGGCCGAAATCGAATCGCTGAAACTCGAGTTTCAGCGATTCGATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-1800s21c1
Sequence:CCGGACTATGGTGCCCGCTCCATTACTCGAGTAATGGAGCGGGCACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-85s21c1
Sequence:CCGGTCGGCTCTTCCTAGGGTTAATCTCGAGATTAACCCTAGGAAGAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009191.3-2188s21c1
Sequence:CCGGTCTTGGTTGTGAGGTTCATAGCTCGAGCTATGAACCTCACAACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-710s21c1
Sequence:CCGGGACTTCAACAACCGGCTAAATCTCGAGATTTAGCCGGTTGTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009191.2-4265s1c1
Sequence:CCGGGCCCATGTATTCTGTGGTTATCTCGAGATAACCACAGAATACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009191.2-1811s1c1
Sequence:CCGGCGCTCCATTAAGCATGAGGTACTCGAGTACCTCATGCTTAATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009191.2-470s1c1
Sequence:CCGGCGGGCCAATAACGTGCAGGAACTCGAGTTCCTGCACGTTATTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009191.2-1503s1c1
Sequence:CCGGGCCGAAATCGAATCGCTGAAACTCGAGTTTCAGCGATTCGATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009191.2-1136s1c1
Sequence:CCGGGCAAAGTATATGCACAAAGATCTCGAGATCTTTGTGCATATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009191
VALIDATED
CLPB MISSION shRNA Lentiviral Transduction Particles
ClpB caseinolytic peptidase B homolog (E. coli)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-1503s21c1
Sequence:CCGGGCCGAAATCGAATCGCTGAAACTCGAGTTTCAGCGATTCGATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-1800s21c1
Sequence:CCGGACTATGGTGCCCGCTCCATTACTCGAGTAATGGAGCGGGCACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-85s21c1
Sequence:CCGGTCGGCTCTTCCTAGGGTTAATCTCGAGATTAACCCTAGGAAGAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009191.3-2188s21c1
Sequence:CCGGTCTTGGTTGTGAGGTTCATAGCTCGAGCTATGAACCTCACAACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009191.3-710s21c1
Sequence:CCGGGACTTCAACAACCGGCTAAATCTCGAGATTTAGCCGGTTGTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009191.2-4265s1c1
Sequence:CCGGGCCCATGTATTCTGTGGTTATCTCGAGATAACCACAGAATACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009191.2-1811s1c1
Sequence:CCGGCGCTCCATTAAGCATGAGGTACTCGAGTACCTCATGCTTAATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009191.2-470s1c1
Sequence:CCGGCGGGCCAATAACGTGCAGGAACTCGAGTTCCTGCACGTTATTGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009191.2-1503s1c1
Sequence:CCGGGCCGAAATCGAATCGCTGAAACTCGAGTTTCAGCGATTCGATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009191.2-1136s1c1
Sequence:CCGGGCAAAGTATATGCACAAAGATCTCGAGATCTTTGTGCATATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks