EMAIL THIS PAGE TO A FRIEND

CLPP

caseinolytic mitochondrial matrix peptidase proteolytic subunit

60 Gene Product Result for
Synonyms: PRLTS3
UniProtKB ID: Q16740, B2R4W5
Gene ID:
Human(8192) Summary: The protein encoded by this gene belongs to the peptidase family S14 and hydrolyzes proteins into small peptides in the presence of ATP and magnesium. The protein is transported into mitochondrial matrix and is associated with the inner mitochondrial membrane. [provided by RefSeq, Jul 2008]
Mouse(53895) ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit
Rat(301117) ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)
Zebrafish(553713) ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)
Thale Cress(844734) ATP-dependent Clp protease proteolytic subunit
domestic cat(101095315) ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)
dog(611738) ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)
cow(535981) ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)
naked mole-rat(101720532) ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)
domestic guinea pig(100722298) ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)
sheep(101106323) ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011941 MISSION® esiRNA esiRNA targeting human CLPP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006012 siRNAs that have been validated in the lab human pricing
XM_001055676 Rosetta Predictions rat pricing
XM_217313 Rosetta Predictions rat pricing
NM_017393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006012 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025718 validated 718
1 SASI_Hs01_00025717 validated 787
1 SASI_Hs01_00025719 validated 288
2 SASI_Hs02_00340720 predicted 701
3 SASI_Hs01_00025721 predicted 827
4 SASI_Hs01_00025722 predicted 514
5 SASI_Hs01_00025723 predicted 639
6 SASI_Hs01_00025724 predicted 442
7 SASI_Hs01_00025725 predicted 890
8 SASI_Hs01_00025726 predicted 399
9 SASI_Hs01_00025720 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280601 predicted 646
2 SASI_Rn02_00280602 predicted 555
3 SASI_Rn02_00280603 predicted 690
4 SASI_Rn02_00280604 predicted 377
5 SASI_Rn02_00280605 predicted 702
6 SASI_Rn02_00280606 predicted 490
7 SASI_Rn02_00280607 predicted 739
8 SASI_Rn02_00280608 predicted 378
9 SASI_Rn02_00280609 predicted 375
10 SASI_Rn02_00280610 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377130 predicted 648
2 SASI_Rn02_00377131 predicted 556
3 SASI_Rn02_00377132 predicted 691
4 SASI_Rn02_00377133 predicted 371
5 SASI_Rn02_00377134 predicted 702
6 SASI_Rn02_00377135 predicted 498
7 SASI_Rn02_00377136 predicted 741
8 SASI_Rn02_00377137 predicted 383
9 SASI_Rn02_00377138 predicted 371
10 SASI_Rn02_00377139 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070959 predicted 721
2 SASI_Mm01_00070960 predicted 247
3 SASI_Mm01_00070961 predicted 411
4 SASI_Mm01_00070962 predicted 318
5 SASI_Mm02_00323894 predicted 230
6 SASI_Mm01_00070963 predicted 348
7 SASI_Mm01_00070964 predicted 352
8 SASI_Mm01_00070965 predicted 668
9 SASI_Mm01_00070966 predicted 521
10 SASI_Mm01_00070967 predicted 302
11 SASI_Mm01_00070958 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006012
VALIDATED
CLPP MISSION shRNA Bacterial Glycerol Stock
caseinolytic mitochondrial matrix peptidase proteolytic subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_006012.1-631s1c1
Sequence:CCGGGCTCTATAACATCTACGCCAACTCGAGTTGGCGTAGATGTTATAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006012.1-421s1c1
Sequence:CCGGCACGATGCAGTACATCCTCAACTCGAGTTGAGGATGTACTGCATCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_006012.1-730s1c1
Sequence:CCGGGTTTGGCATCTTAGACAAGGTCTCGAGACCTTGTCTAAGATGCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006012.1-619s1c1
Sequence:CCGGGCTCAAGAAGCAGCTCTATAACTCGAGTTATAGAGCTGCTTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006012.1-358s1c1
Sequence:CCGGGCCCATCCACATGTACATCAACTCGAGTTGATGTACATGTGGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-723s21c1
Sequence:CCGGGCTCAAGAAGCAGCTCTATAACTCGAGTTATAGAGCTGCTTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-834s21c1
Sequence:CCGGGTTTGGCATCTTAGACAAGGTCTCGAGACCTTGTCTAAGATGCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-462s21c1
Sequence:CCGGGCCCATCCACATGTACATCAACTCGAGTTGATGTACATGTGGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-525s21c1
Sequence:CCGGCACGATGCAGTACATCCTCAACTCGAGTTGAGGATGTACTGCATCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006012
VALIDATED
CLPP MISSION shRNA shRNA Plasmid DNA
caseinolytic mitochondrial matrix peptidase proteolytic subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_006012.1-631s1c1
Sequence:CCGGGCTCTATAACATCTACGCCAACTCGAGTTGGCGTAGATGTTATAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006012.1-421s1c1
Sequence:CCGGCACGATGCAGTACATCCTCAACTCGAGTTGAGGATGTACTGCATCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_006012.1-730s1c1
Sequence:CCGGGTTTGGCATCTTAGACAAGGTCTCGAGACCTTGTCTAAGATGCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006012.1-619s1c1
Sequence:CCGGGCTCAAGAAGCAGCTCTATAACTCGAGTTATAGAGCTGCTTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006012.1-358s1c1
Sequence:CCGGGCCCATCCACATGTACATCAACTCGAGTTGATGTACATGTGGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-723s21c1
Sequence:CCGGGCTCAAGAAGCAGCTCTATAACTCGAGTTATAGAGCTGCTTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-834s21c1
Sequence:CCGGGTTTGGCATCTTAGACAAGGTCTCGAGACCTTGTCTAAGATGCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-462s21c1
Sequence:CCGGGCCCATCCACATGTACATCAACTCGAGTTGATGTACATGTGGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-525s21c1
Sequence:CCGGCACGATGCAGTACATCCTCAACTCGAGTTGAGGATGTACTGCATCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006012
VALIDATED
CLPP MISSION shRNA Lentiviral Transduction Particles
caseinolytic mitochondrial matrix peptidase proteolytic subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_006012.1-631s1c1
Sequence:CCGGGCTCTATAACATCTACGCCAACTCGAGTTGGCGTAGATGTTATAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006012.1-421s1c1
Sequence:CCGGCACGATGCAGTACATCCTCAACTCGAGTTGAGGATGTACTGCATCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_006012.1-730s1c1
Sequence:CCGGGTTTGGCATCTTAGACAAGGTCTCGAGACCTTGTCTAAGATGCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006012.1-619s1c1
Sequence:CCGGGCTCAAGAAGCAGCTCTATAACTCGAGTTATAGAGCTGCTTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006012.1-358s1c1
Sequence:CCGGGCCCATCCACATGTACATCAACTCGAGTTGATGTACATGTGGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-723s21c1
Sequence:CCGGGCTCAAGAAGCAGCTCTATAACTCGAGTTATAGAGCTGCTTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-834s21c1
Sequence:CCGGGTTTGGCATCTTAGACAAGGTCTCGAGACCTTGTCTAAGATGCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-462s21c1
Sequence:CCGGGCCCATCCACATGTACATCAACTCGAGTTGATGTACATGTGGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006012.2-525s21c1
Sequence:CCGGCACGATGCAGTACATCCTCAACTCGAGTTGAGGATGTACTGCATCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017393
VALIDATED
CLPP MISSION shRNA Bacterial Glycerol Stock
caseinolytic mitochondrial matrix peptidase proteolytic subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-632s1c1
Sequence:CCGGGCTATACAACATCTACGCCAACTCGAGTTGGCGTAGATGTTGTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-359s1c1
Sequence:CCGGGCCCATTCATATGTATATCAACTCGAGTTGATATACATATGAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-530s1c1
Sequence:CCGGGCCCAATTCCAGAATCATGATCTCGAGATCATGATTCTGGAATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-327s1c1
Sequence:CCGGCTGTTGTTCTTACAGTCTGAACTCGAGTTCAGACTGTAAGAACAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-227s1c1
Sequence:CCGGCGAGCGCGCTTATGACATATACTCGAGTATATGTCATAAGCGCGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-530s21c1
Sequence:CCGGGCCCAATTCCAGAATCATGATCTCGAGATCATGATTCTGGAATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-359s21c1
Sequence:CCGGGCCCATTCATATGTATATCAACTCGAGTTGATATACATATGAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-227s21c1
Sequence:CCGGCGAGCGCGCTTATGACATATACTCGAGTATATGTCATAAGCGCGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-632s21c1
Sequence:CCGGGCTATACAACATCTACGCCAACTCGAGTTGGCGTAGATGTTGTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-327s21c1
Sequence:CCGGCTGTTGTTCTTACAGTCTGAACTCGAGTTCAGACTGTAAGAACAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017393
VALIDATED
CLPP MISSION shRNA shRNA Plasmid DNA
caseinolytic mitochondrial matrix peptidase proteolytic subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-632s1c1
Sequence:CCGGGCTATACAACATCTACGCCAACTCGAGTTGGCGTAGATGTTGTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-359s1c1
Sequence:CCGGGCCCATTCATATGTATATCAACTCGAGTTGATATACATATGAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-530s1c1
Sequence:CCGGGCCCAATTCCAGAATCATGATCTCGAGATCATGATTCTGGAATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-327s1c1
Sequence:CCGGCTGTTGTTCTTACAGTCTGAACTCGAGTTCAGACTGTAAGAACAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-227s1c1
Sequence:CCGGCGAGCGCGCTTATGACATATACTCGAGTATATGTCATAAGCGCGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-530s21c1
Sequence:CCGGGCCCAATTCCAGAATCATGATCTCGAGATCATGATTCTGGAATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-359s21c1
Sequence:CCGGGCCCATTCATATGTATATCAACTCGAGTTGATATACATATGAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-227s21c1
Sequence:CCGGCGAGCGCGCTTATGACATATACTCGAGTATATGTCATAAGCGCGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-632s21c1
Sequence:CCGGGCTATACAACATCTACGCCAACTCGAGTTGGCGTAGATGTTGTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-327s21c1
Sequence:CCGGCTGTTGTTCTTACAGTCTGAACTCGAGTTCAGACTGTAAGAACAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017393
VALIDATED
CLPP MISSION shRNA Lentiviral Transduction Particles
caseinolytic mitochondrial matrix peptidase proteolytic subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-632s1c1
Sequence:CCGGGCTATACAACATCTACGCCAACTCGAGTTGGCGTAGATGTTGTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-359s1c1
Sequence:CCGGGCCCATTCATATGTATATCAACTCGAGTTGATATACATATGAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-530s1c1
Sequence:CCGGGCCCAATTCCAGAATCATGATCTCGAGATCATGATTCTGGAATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-327s1c1
Sequence:CCGGCTGTTGTTCTTACAGTCTGAACTCGAGTTCAGACTGTAAGAACAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017393.1-227s1c1
Sequence:CCGGCGAGCGCGCTTATGACATATACTCGAGTATATGTCATAAGCGCGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-530s21c1
Sequence:CCGGGCCCAATTCCAGAATCATGATCTCGAGATCATGATTCTGGAATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-359s21c1
Sequence:CCGGGCCCATTCATATGTATATCAACTCGAGTTGATATACATATGAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-227s21c1
Sequence:CCGGCGAGCGCGCTTATGACATATACTCGAGTATATGTCATAAGCGCGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-632s21c1
Sequence:CCGGGCTATACAACATCTACGCCAACTCGAGTTGGCGTAGATGTTGTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017393.1-327s21c1
Sequence:CCGGCTGTTGTTCTTACAGTCTGAACTCGAGTTCAGACTGTAAGAACAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)