EMAIL THIS PAGE TO A FRIEND

CLPS

colipase, pancreatic

71 Gene Product Result for
UniProtKB ID: P04118, Q5T9G7, Q5U809
Gene ID:
Human(1208) Summary: The protein encoded by this gene is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilizing an active conformation and considerably increasing the overall hydrophobic binding site. The gene product allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. This cofactor is only expressed in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(109791) colipase, pancreatic
Rat(25680) colipase, pancreatic
chicken(771102) colipase, pancreatic
dog(403970) colipase, pancreatic
domestic cat(101100391) colipase, pancreatic
Horse(100053646) colipase, pancreatic
cow(525923) colipase, pancreatic
sheep(101119081) colipase, pancreatic
Domestic Rabbit(100009061) colipase, pancreatic
domestic guinea pig(100723751) colipase, pancreatic
naked mole-rat(101718096) colipase, pancreatic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001832 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001832 Rosetta Predictions human pricing
NM_013139 Rosetta Predictions rat pricing
NM_025469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200098 predicted 238
2 SASI_Hs01_00200100 predicted 218
3 SASI_Hs01_00200102 predicted 230
4 SASI_Hs01_00200105 predicted 244
5 SASI_Hs02_00332638 predicted 237
6 SASI_Hs01_00200096 predicted 240
7 SASI_Hs01_00200097 predicted 245
8 SASI_Hs01_00200099 predicted 285
9 SASI_Hs01_00200101 predicted 213
10 SASI_Hs01_00200103 predicted 276
11 SASI_Hs01_00200104 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071698 predicted 260
2 SASI_Rn01_00071699 predicted 220
3 SASI_Rn01_00071700 predicted 260
4 SASI_Rn01_00071701 predicted 202
5 SASI_Rn01_00071702 predicted 206
6 SASI_Rn01_00071703 predicted 205
7 SASI_Rn01_00071704 predicted 217
8 SASI_Rn01_00071705 predicted 220
9 SASI_Rn01_00071706 predicted 233
10 SASI_Rn01_00071707 predicted 140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166713 predicted 211
2 SASI_Mm01_00166718 predicted 211
3 SASI_Mm01_00166719 predicted 210
4 SASI_Mm01_00166711 predicted 253
5 SASI_Mm01_00166712 predicted 221
6 SASI_Mm01_00166714 predicted 202
7 SASI_Mm01_00166715 predicted 260
8 SASI_Mm01_00166716 predicted 206
9 SASI_Mm01_00166717 predicted 266
10 SASI_Mm01_00166720 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001832
CLPS MISSION shRNA Bacterial Glycerol Stock
colipase, pancreatic
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001832.2-321s21c1
Sequence:CCGGCCATCACCAACACCAACTTTGCTCGAGCAAAGTTGGTGTTGGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001832.2-286s21c1
Sequence:CCGGCCTGACCTGTGAGGGAGACAACTCGAGTTGTCTCCCTCACAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-147s1c2
Sequence:CCGGGTGCCCAGTGTAAGAGCAATTCTCGAGAATTGCTCTTACACTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-233s1c2
Sequence:CCGGTGCTCTGTCAAGACGCTCTATCTCGAGATAGAGCGTCTTGACAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001832.2-113s21c1
Sequence:CCGGATCAACCTGGAGAACGGTGAGCTCGAGCTCACCGTTCTCCAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-138s1c1
Sequence:CCGGGCATGAATAGTGCCCAGTGTACTCGAGTACACTGGGCACTATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-247s1c1
Sequence:CCGGGCTCTATGGGATTTACTACAACTCGAGTTGTAGTAAATCCCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-241s1c1
Sequence:CCGGCAAGACGCTCTATGGGATTTACTCGAGTAAATCCCATAGAGCGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001832
CLPS MISSION shRNA shRNA Plasmid DNA
colipase, pancreatic
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001832.2-321s21c1
Sequence:CCGGCCATCACCAACACCAACTTTGCTCGAGCAAAGTTGGTGTTGGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001832.2-286s21c1
Sequence:CCGGCCTGACCTGTGAGGGAGACAACTCGAGTTGTCTCCCTCACAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-147s1c2
Sequence:CCGGGTGCCCAGTGTAAGAGCAATTCTCGAGAATTGCTCTTACACTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-233s1c2
Sequence:CCGGTGCTCTGTCAAGACGCTCTATCTCGAGATAGAGCGTCTTGACAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001832.2-113s21c1
Sequence:CCGGATCAACCTGGAGAACGGTGAGCTCGAGCTCACCGTTCTCCAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-138s1c1
Sequence:CCGGGCATGAATAGTGCCCAGTGTACTCGAGTACACTGGGCACTATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-247s1c1
Sequence:CCGGGCTCTATGGGATTTACTACAACTCGAGTTGTAGTAAATCCCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-241s1c1
Sequence:CCGGCAAGACGCTCTATGGGATTTACTCGAGTAAATCCCATAGAGCGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001832
CLPS MISSION shRNA Lentiviral Transduction Particles
colipase, pancreatic
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001832.2-321s21c1
Sequence:CCGGCCATCACCAACACCAACTTTGCTCGAGCAAAGTTGGTGTTGGTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001832.2-286s21c1
Sequence:CCGGCCTGACCTGTGAGGGAGACAACTCGAGTTGTCTCCCTCACAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-147s1c2
Sequence:CCGGGTGCCCAGTGTAAGAGCAATTCTCGAGAATTGCTCTTACACTGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-233s1c2
Sequence:CCGGTGCTCTGTCAAGACGCTCTATCTCGAGATAGAGCGTCTTGACAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001832.2-113s21c1
Sequence:CCGGATCAACCTGGAGAACGGTGAGCTCGAGCTCACCGTTCTCCAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-138s1c1
Sequence:CCGGGCATGAATAGTGCCCAGTGTACTCGAGTACACTGGGCACTATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-247s1c1
Sequence:CCGGGCTCTATGGGATTTACTACAACTCGAGTTGTAGTAAATCCCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001832.2-241s1c1
Sequence:CCGGCAAGACGCTCTATGGGATTTACTCGAGTAAATCCCATAGAGCGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025469
CLPS MISSION shRNA Bacterial Glycerol Stock
colipase, pancreatic
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-223s1c2
Sequence:CCGGCCGTTGCACACACAAGGCCATCTCGAGATGGCCTTGTGTGTGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-344s1c1
Sequence:CCGGGCCATCACCAACACCAACTATCTCGAGATAGTTGGTGTTGGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-130s1c1
Sequence:CCGGTCTTATTATCAACCTGGAGGACTCGAGTCCTCCAGGTTGATAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-89s1c1
Sequence:CCGGTCCCTCCTTGCAGTGGCCTATCTCGAGATAGGCCACTGCAAGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-171s1c1
Sequence:CCGGGTATGCAGTGTAAGAGCAGATCTCGAGATCTGCTCTTACACTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025469
CLPS MISSION shRNA shRNA Plasmid DNA
colipase, pancreatic
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-223s1c2
Sequence:CCGGCCGTTGCACACACAAGGCCATCTCGAGATGGCCTTGTGTGTGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-344s1c1
Sequence:CCGGGCCATCACCAACACCAACTATCTCGAGATAGTTGGTGTTGGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-130s1c1
Sequence:CCGGTCTTATTATCAACCTGGAGGACTCGAGTCCTCCAGGTTGATAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-89s1c1
Sequence:CCGGTCCCTCCTTGCAGTGGCCTATCTCGAGATAGGCCACTGCAAGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-171s1c1
Sequence:CCGGGTATGCAGTGTAAGAGCAGATCTCGAGATCTGCTCTTACACTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025469
CLPS MISSION shRNA Lentiviral Transduction Particles
colipase, pancreatic
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-223s1c2
Sequence:CCGGCCGTTGCACACACAAGGCCATCTCGAGATGGCCTTGTGTGTGCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-344s1c1
Sequence:CCGGGCCATCACCAACACCAACTATCTCGAGATAGTTGGTGTTGGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-130s1c1
Sequence:CCGGTCTTATTATCAACCTGGAGGACTCGAGTCCTCCAGGTTGATAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-89s1c1
Sequence:CCGGTCCCTCCTTGCAGTGGCCTATCTCGAGATAGGCCACTGCAAGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025469.1-171s1c1
Sequence:CCGGGTATGCAGTGTAAGAGCAGATCTCGAGATCTGCTCTTACACTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks