EMAIL THIS PAGE TO A FRIEND

CLPSL1

colipase-like 1

Synonyms: C6orf127 ESP32 dJ510O8.6
UniProtKB ID: A2RUU4, A7E2T6, B2RPE2, B5G4V2, B6ZDM9, Q5T9G1
Gene ID:
cow(101902064) colipase-like 1
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010886 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010886 Rosetta Predictions human pricing
XM_929785 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305840 predicted 200
2 SASI_Hs02_00305841 predicted 200
3 SASI_Hs02_00305842 predicted 202
4 SASI_Hs02_00305843 predicted 357
5 SASI_Hs02_00305844 predicted 316
6 SASI_Hs02_00305845 predicted 361
7 SASI_Hs02_00305846 predicted 183
8 SASI_Hs02_00305847 predicted 271
9 SASI_Hs02_00305848 predicted 315
10 SASI_Hs02_00305849 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296714 predicted 209
2 SASI_Hs01_00296715 predicted 207
3 SASI_Hs01_00296716 predicted 206
4 SASI_Hs01_00296717 predicted 373
5 SASI_Hs01_00296718 predicted 318
6 SASI_Hs01_00296719 predicted 364
7 SASI_Hs01_00296720 predicted 199
8 SASI_Hs01_00296721 predicted 278
9 SASI_Hs01_00296722 predicted 325
10 SASI_Hs01_00296723 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010886
CLPSL1 MISSION shRNA Bacterial Glycerol Stock
colipase-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-323s1c1
Sequence:CCGGCTGCGGAACCTGACTTGTATACTCGAGTATACAAGTCAGGTTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-399s1c1
Sequence:CCGGGAAGGCAGAAGTTGGCTAAGACTCGAGTCTTAGCCAACTTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-286s1c1
Sequence:CCGGGCAGGTGTTCTTTGGCCAATACTCGAGTATTGGCCAAAGAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-277s1c1
Sequence:CCGGGTGTCAAACGCAGGTGTTCTTCTCGAGAAGAACACCTGCGTTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-325s1c1
Sequence:CCGGGCGGAACCTGACTTGTATATACTCGAGTATATACAAGTCAGGTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-106s1c1
Sequence:CCGGCTTCTTCTTTCTCTTCCTCCTCTCGAGAGGAGGAAGAGAAAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-94s1c1
Sequence:CCGGGCTGTTCCTTCTCTTCTTCTTCTCGAGAAGAAGAAGAGAAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-352s1c1
Sequence:CCGGGAATGAGAAATGGCTTAGCATCTCGAGATGCTAAGCCATTTCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-326s1c1
Sequence:CCGGCGGAACCTGACTTGTATATATCTCGAGATATATACAAGTCAGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-287s1c1
Sequence:CCGGCAGGTGTTCTTTGGCCAATATCTCGAGATATTGGCCAAAGAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010886
CLPSL1 MISSION shRNA shRNA Plasmid DNA
colipase-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-323s1c1
Sequence:CCGGCTGCGGAACCTGACTTGTATACTCGAGTATACAAGTCAGGTTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-399s1c1
Sequence:CCGGGAAGGCAGAAGTTGGCTAAGACTCGAGTCTTAGCCAACTTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-286s1c1
Sequence:CCGGGCAGGTGTTCTTTGGCCAATACTCGAGTATTGGCCAAAGAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-277s1c1
Sequence:CCGGGTGTCAAACGCAGGTGTTCTTCTCGAGAAGAACACCTGCGTTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-325s1c1
Sequence:CCGGGCGGAACCTGACTTGTATATACTCGAGTATATACAAGTCAGGTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-106s1c1
Sequence:CCGGCTTCTTCTTTCTCTTCCTCCTCTCGAGAGGAGGAAGAGAAAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-94s1c1
Sequence:CCGGGCTGTTCCTTCTCTTCTTCTTCTCGAGAAGAAGAAGAGAAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-352s1c1
Sequence:CCGGGAATGAGAAATGGCTTAGCATCTCGAGATGCTAAGCCATTTCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-326s1c1
Sequence:CCGGCGGAACCTGACTTGTATATATCTCGAGATATATACAAGTCAGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-287s1c1
Sequence:CCGGCAGGTGTTCTTTGGCCAATATCTCGAGATATTGGCCAAAGAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010886
CLPSL1 MISSION shRNA Lentiviral Transduction Particles
colipase-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-323s1c1
Sequence:CCGGCTGCGGAACCTGACTTGTATACTCGAGTATACAAGTCAGGTTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-399s1c1
Sequence:CCGGGAAGGCAGAAGTTGGCTAAGACTCGAGTCTTAGCCAACTTCTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-286s1c1
Sequence:CCGGGCAGGTGTTCTTTGGCCAATACTCGAGTATTGGCCAAAGAACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-277s1c1
Sequence:CCGGGTGTCAAACGCAGGTGTTCTTCTCGAGAAGAACACCTGCGTTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-325s1c1
Sequence:CCGGGCGGAACCTGACTTGTATATACTCGAGTATATACAAGTCAGGTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-106s1c1
Sequence:CCGGCTTCTTCTTTCTCTTCCTCCTCTCGAGAGGAGGAAGAGAAAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-94s1c1
Sequence:CCGGGCTGTTCCTTCTCTTCTTCTTCTCGAGAAGAAGAAGAGAAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010886.1-352s1c1
Sequence:CCGGGAATGAGAAATGGCTTAGCATCTCGAGATGCTAAGCCATTTCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-326s1c1
Sequence:CCGGCGGAACCTGACTTGTATATATCTCGAGATATATACAAGTCAGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010886.1-287s1c1
Sequence:CCGGCAGGTGTTCTTTGGCCAATATCTCGAGATATTGGCCAAAGAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks