EMAIL THIS PAGE TO A FRIEND

CLPSL2

colipase-like 2

45 Gene Product Result for
Synonyms: C6orf126 UNQ3045 dJ510O8.5
UniProtKB ID: Q6UWE3, B0QZ45, Q5T9G3
Gene ID:
Mouse(328788) colipase-like 2
Rat(689425) colipase-like 2
domestic cat(101090519) colipase-like 2
cow(100297290) colipase-like 2
sheep(101122733) colipase-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371815 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001034871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207409 Rosetta Predictions human pricing
NM_001135002 Rosetta Predictions rat pricing
NM_001034871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374029 predicted 249
2 SASI_Hs01_00064164 predicted 242
3 SASI_Hs01_00064166 predicted 92
4 SASI_Hs02_00374030 predicted 285
5 SASI_Hs01_00064171 predicted 350
6 SASI_Hs01_00064172 predicted 353
7 SASI_Hs02_00374031 predicted 251
8 SASI_Hs02_00374032 predicted 279
9 SASI_Hs02_00374033 predicted 178
10 SASI_Hs02_00374034 predicted 371
11 SASI_Hs01_00064163 predicted 423
12 SASI_Hs01_00064165 predicted 367
13 SASI_Hs01_00064167 predicted 65
14 SASI_Hs01_00064168 predicted 108
15 SASI_Hs01_00064169 predicted 434
16 SASI_Hs01_00064170 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001135002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259367 predicted 244
2 SASI_Rn02_00259368 predicted 227
3 SASI_Rn02_00259369 predicted 241
4 SASI_Rn02_00259370 predicted 237
5 SASI_Rn02_00259371 predicted 225
6 SASI_Rn02_00259372 predicted 196
7 SASI_Rn02_00259373 predicted 228
8 SASI_Rn02_00259374 predicted 205
9 SASI_Rn02_00259375 predicted 243
10 SASI_Rn02_00259376 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029220 predicted 152
2 SASI_Mm01_00029221 predicted 277
3 SASI_Mm01_00029222 predicted 139
4 SASI_Mm01_00029223 predicted 276
5 SASI_Mm01_00029224 predicted 403
6 SASI_Mm01_00029225 predicted 279
7 SASI_Mm01_00029226 predicted 275
8 SASI_Mm01_00029227 predicted 157
9 SASI_Mm01_00029228 predicted 269
10 SASI_Mm01_00029229 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371815
CLPSL2 MISSION shRNA Bacterial Glycerol Stock
colipase-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-279s1c1
Sequence:CCGGGATGAAAGGAAGAGCCCAGATCTCGAGATCTGGGCTCTTCCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371815.1-240s1c1
Sequence:CCGGGATGGCTACACACACCTTTCTCTCGAGAGAAAGGTGTGTGTAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-222s1c1
Sequence:CCGGGCTGGCATCCTTGAGAAAGATCTCGAGATCTTTCTCAAGGATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371815.1-287s1c1
Sequence:CCGGGAAGAGCCCAGATTCACAGTACTCGAGTACTGTGAATCTGGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-231s1c1
Sequence:CCGGCTTGAGAAAGATGGCTACACACTCGAGTGTGTAGCCATCTTTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-612s1c1
Sequence:CCGGCAGAATAACCATGATCTGCTTCTCGAGAAGCAGATCATGGTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-261s1c1
Sequence:CCGGGCAGGAGAGTTACTTCATGATCTCGAGATCATGAAGTAACTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371815
CLPSL2 MISSION shRNA shRNA Plasmid DNA
colipase-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-279s1c1
Sequence:CCGGGATGAAAGGAAGAGCCCAGATCTCGAGATCTGGGCTCTTCCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371815.1-240s1c1
Sequence:CCGGGATGGCTACACACACCTTTCTCTCGAGAGAAAGGTGTGTGTAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-222s1c1
Sequence:CCGGGCTGGCATCCTTGAGAAAGATCTCGAGATCTTTCTCAAGGATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371815.1-287s1c1
Sequence:CCGGGAAGAGCCCAGATTCACAGTACTCGAGTACTGTGAATCTGGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-231s1c1
Sequence:CCGGCTTGAGAAAGATGGCTACACACTCGAGTGTGTAGCCATCTTTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-612s1c1
Sequence:CCGGCAGAATAACCATGATCTGCTTCTCGAGAAGCAGATCATGGTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-261s1c1
Sequence:CCGGGCAGGAGAGTTACTTCATGATCTCGAGATCATGAAGTAACTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371815
CLPSL2 MISSION shRNA Lentiviral Transduction Particles
colipase-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-279s1c1
Sequence:CCGGGATGAAAGGAAGAGCCCAGATCTCGAGATCTGGGCTCTTCCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371815.1-240s1c1
Sequence:CCGGGATGGCTACACACACCTTTCTCTCGAGAGAAAGGTGTGTGTAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-222s1c1
Sequence:CCGGGCTGGCATCCTTGAGAAAGATCTCGAGATCTTTCTCAAGGATGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371815.1-287s1c1
Sequence:CCGGGAAGAGCCCAGATTCACAGTACTCGAGTACTGTGAATCTGGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-231s1c1
Sequence:CCGGCTTGAGAAAGATGGCTACACACTCGAGTGTGTAGCCATCTTTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-612s1c1
Sequence:CCGGCAGAATAACCATGATCTGCTTCTCGAGAAGCAGATCATGGTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371815.1-261s1c1
Sequence:CCGGGCAGGAGAGTTACTTCATGATCTCGAGATCATGAAGTAACTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034871
CLPSL2 MISSION shRNA Bacterial Glycerol Stock
colipase-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-270s21c1
Sequence:CCGGCTGTCGATCTGGCTTGAATTGCTCGAGCAATTCAAGCCAGATCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-155s21c1
Sequence:CCGGCCAGTGACTGTTGCCTCATAGCTCGAGCTATGAGGCAACAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-125s21c1
Sequence:CCGGGAGACAAGTGTGTCCACCACACTCGAGTGTGGTGGACACACTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-80s21c1
Sequence:CCGGTGCCACACAGACACAGTGAAACTCGAGTTTCACTGTGTCTGTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-248s21c1
Sequence:CCGGGGAGCCTGAACATCATGTGTCCTCGAGGACACATGATGTTCAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034871
CLPSL2 MISSION shRNA shRNA Plasmid DNA
colipase-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-270s21c1
Sequence:CCGGCTGTCGATCTGGCTTGAATTGCTCGAGCAATTCAAGCCAGATCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-155s21c1
Sequence:CCGGCCAGTGACTGTTGCCTCATAGCTCGAGCTATGAGGCAACAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-125s21c1
Sequence:CCGGGAGACAAGTGTGTCCACCACACTCGAGTGTGGTGGACACACTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-80s21c1
Sequence:CCGGTGCCACACAGACACAGTGAAACTCGAGTTTCACTGTGTCTGTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-248s21c1
Sequence:CCGGGGAGCCTGAACATCATGTGTCCTCGAGGACACATGATGTTCAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034871
CLPSL2 MISSION shRNA Lentiviral Transduction Particles
colipase-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-270s21c1
Sequence:CCGGCTGTCGATCTGGCTTGAATTGCTCGAGCAATTCAAGCCAGATCGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-155s21c1
Sequence:CCGGCCAGTGACTGTTGCCTCATAGCTCGAGCTATGAGGCAACAGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-125s21c1
Sequence:CCGGGAGACAAGTGTGTCCACCACACTCGAGTGTGGTGGACACACTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-80s21c1
Sequence:CCGGTGCCACACAGACACAGTGAAACTCGAGTTTCACTGTGTCTGTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034871.2-248s21c1
Sequence:CCGGGGAGCCTGAACATCATGTGTCCTCGAGGACACATGATGTTCAGGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks