EMAIL THIS PAGE TO A FRIEND

CLPTM1

cleft lip and palate associated transmembrane protein 1

UniProtKB ID: O96005, Q53ET6, Q9BSS5
Gene ID:
Mouse(56457) cleft lip and palate associated transmembrane protein 1
Rat(292696) cleft lip and palate associated transmembrane protein 1
sheep(101112757) cleft lip and palate associated transmembrane protein 1
Domestic Rabbit(100357799) cleft lip and palate associated transmembrane protein 1
domestic guinea pig(100731910) cleft lip and palate associated transmembrane protein 1
naked mole-rat(101718929) cleft lip and palate associated transmembrane protein 1
Zebrafish(795480) cleft lip and palate associated transmembrane protein 1
cow(618037) cleft lip and palate associated transmembrane protein 1
Horse(100070653) cleft lip and palate associated transmembrane protein 1
domestic cat(101086019) cleft lip and palate associated transmembrane protein 1
dog(484455) cleft lip and palate associated transmembrane protein 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001294 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001294 Rosetta Predictions human pricing
NM_001106232 Rosetta Predictions rat pricing
NM_019649 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331554 predicted 1472
2 SASI_Hs01_00097599 predicted 1222
3 SASI_Hs01_00097600 predicted 450
4 SASI_Hs01_00097601 predicted 734
5 SASI_Hs01_00097602 predicted 1788
6 SASI_Hs01_00097603 predicted 313
7 SASI_Hs01_00097604 predicted 510
8 SASI_Hs01_00097605 predicted 398
9 SASI_Hs01_00097606 predicted 990
10 SASI_Hs01_00097607 predicted 824
11 SASI_Hs01_00097598 predicted 1654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216938 predicted 1789
2 SASI_Rn02_00216939 predicted 1217
3 SASI_Rn02_00216940 predicted 601
4 SASI_Rn02_00216941 predicted 499
5 SASI_Rn02_00216942 predicted 687
6 SASI_Rn02_00216943 predicted 481
7 SASI_Rn02_00216944 predicted 1354
8 SASI_Rn02_00216945 predicted 1250
9 SASI_Rn02_00216946 predicted 1582
10 SASI_Rn02_00216947 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056086 predicted 1805
2 SASI_Mm01_00056087 predicted 1682
3 SASI_Mm01_00056088 predicted 498
4 SASI_Mm01_00056089 predicted 1263
5 SASI_Mm01_00056090 predicted 948
6 SASI_Mm01_00056091 predicted 1370
7 SASI_Mm01_00056092 predicted 749
8 SASI_Mm01_00056093 predicted 1226
9 SASI_Mm01_00056094 predicted 1356
10 SASI_Mm01_00056095 predicted 1405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001294
VALIDATED
CLPTM1 MISSION shRNA Bacterial Glycerol Stock
cleft lip and palate associated transmembrane protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001294.1-2198s21c1
Sequence:CCGGTTGTTTGTGGAGGCGCTGTCTCTCGAGAGACAGCGCCTCCACAAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-798s21c1
Sequence:CCGGCCTGGATCAATATGTGAAGTTCTCGAGAACTTCACATATTGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-501s21c1
Sequence:CCGGCTCCATCTACATCCACGTTTACTCGAGTAAACGTGGATGTAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-1386s21c1
Sequence:CCGGCAAGGACAAGTCCACGTATATCTCGAGATATACGTGGACTTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-456s21c1
Sequence:CCGGGCACTTTGCTGAGCTCGATATCTCGAGATATCGAGCTCAGCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001294.1-2268s1c1
Sequence:CCGGACCACTGGGAATCATGGTGAACTCGAGTTCACCATGATTCCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001294.1-798s1c1
Sequence:CCGGCCTGGATCAATATGTGAAGTTCTCGAGAACTTCACATATTGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001294.1-192s1c1
Sequence:CCGGGCTGTTTAGGATCTTCATCATCTCGAGATGATGAAGATCCTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001294.1-501s1c1
Sequence:CCGGCTCCATCTACATCCACGTTTACTCGAGTAAACGTGGATGTAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001294.1-1415s1c1
Sequence:CCGGCGACCAAAGTGTATGATGATACTCGAGTATCATCATACACTTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001294
VALIDATED
CLPTM1 MISSION shRNA shRNA Plasmid DNA
cleft lip and palate associated transmembrane protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001294.1-2198s21c1
Sequence:CCGGTTGTTTGTGGAGGCGCTGTCTCTCGAGAGACAGCGCCTCCACAAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-798s21c1
Sequence:CCGGCCTGGATCAATATGTGAAGTTCTCGAGAACTTCACATATTGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-501s21c1
Sequence:CCGGCTCCATCTACATCCACGTTTACTCGAGTAAACGTGGATGTAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-1386s21c1
Sequence:CCGGCAAGGACAAGTCCACGTATATCTCGAGATATACGTGGACTTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-456s21c1
Sequence:CCGGGCACTTTGCTGAGCTCGATATCTCGAGATATCGAGCTCAGCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001294.1-2268s1c1
Sequence:CCGGACCACTGGGAATCATGGTGAACTCGAGTTCACCATGATTCCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001294.1-798s1c1
Sequence:CCGGCCTGGATCAATATGTGAAGTTCTCGAGAACTTCACATATTGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001294.1-192s1c1
Sequence:CCGGGCTGTTTAGGATCTTCATCATCTCGAGATGATGAAGATCCTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001294.1-501s1c1
Sequence:CCGGCTCCATCTACATCCACGTTTACTCGAGTAAACGTGGATGTAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001294.1-1415s1c1
Sequence:CCGGCGACCAAAGTGTATGATGATACTCGAGTATCATCATACACTTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001294
VALIDATED
CLPTM1 MISSION shRNA Lentiviral Transduction Particles
cleft lip and palate associated transmembrane protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001294.1-2198s21c1
Sequence:CCGGTTGTTTGTGGAGGCGCTGTCTCTCGAGAGACAGCGCCTCCACAAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-798s21c1
Sequence:CCGGCCTGGATCAATATGTGAAGTTCTCGAGAACTTCACATATTGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-501s21c1
Sequence:CCGGCTCCATCTACATCCACGTTTACTCGAGTAAACGTGGATGTAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-1386s21c1
Sequence:CCGGCAAGGACAAGTCCACGTATATCTCGAGATATACGTGGACTTGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001294.1-456s21c1
Sequence:CCGGGCACTTTGCTGAGCTCGATATCTCGAGATATCGAGCTCAGCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001294.1-2268s1c1
Sequence:CCGGACCACTGGGAATCATGGTGAACTCGAGTTCACCATGATTCCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001294.1-798s1c1
Sequence:CCGGCCTGGATCAATATGTGAAGTTCTCGAGAACTTCACATATTGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001294.1-192s1c1
Sequence:CCGGGCTGTTTAGGATCTTCATCATCTCGAGATGATGAAGATCCTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001294.1-501s1c1
Sequence:CCGGCTCCATCTACATCCACGTTTACTCGAGTAAACGTGGATGTAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001294.1-1415s1c1
Sequence:CCGGCGACCAAAGTGTATGATGATACTCGAGTATCATCATACACTTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019649
VALIDATED
CLPTM1 MISSION shRNA Bacterial Glycerol Stock
cleft lip and palate associated transmembrane protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019649.2-3002s1c1
Sequence:CCGGCAAGAAGGACAAGCCCTATTTCTCGAGAAATAGGGCTTGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019649.1-1653s1c1
Sequence:CCGGGCCCTCAACACTTTCATTGATCTCGAGATCAATGAAAGTGTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019649.1-489s1c1
Sequence:CCGGGCAGAATGGCTCCATCTATATCTCGAGATATAGATGGAGCCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019649.1-1658s1c1
Sequence:CCGGCAACACTTTCATTGATGACTTCTCGAGAAGTCATCAATGAAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019649.1-497s1c1
Sequence:CCGGGCTCCATCTATATCCATGTCTCTCGAGAGACATGGATATAGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019649.1-1584s1c1
Sequence:CCGGCCACAGCTCTTCATCAACTATCTCGAGATAGTTGATGAAGAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019649.1-1231s1c1
Sequence:CCGGCTCCTTTACATCCTGGACAATCTCGAGATTGTCCAGGATGTAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019649
VALIDATED
CLPTM1 MISSION shRNA shRNA Plasmid DNA
cleft lip and palate associated transmembrane protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019649.2-3002s1c1
Sequence:CCGGCAAGAAGGACAAGCCCTATTTCTCGAGAAATAGGGCTTGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019649.1-1653s1c1
Sequence:CCGGGCCCTCAACACTTTCATTGATCTCGAGATCAATGAAAGTGTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019649.1-489s1c1
Sequence:CCGGGCAGAATGGCTCCATCTATATCTCGAGATATAGATGGAGCCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019649.1-1658s1c1
Sequence:CCGGCAACACTTTCATTGATGACTTCTCGAGAAGTCATCAATGAAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019649.1-497s1c1
Sequence:CCGGGCTCCATCTATATCCATGTCTCTCGAGAGACATGGATATAGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019649.1-1584s1c1
Sequence:CCGGCCACAGCTCTTCATCAACTATCTCGAGATAGTTGATGAAGAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019649.1-1231s1c1
Sequence:CCGGCTCCTTTACATCCTGGACAATCTCGAGATTGTCCAGGATGTAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019649
VALIDATED
CLPTM1 MISSION shRNA Lentiviral Transduction Particles
cleft lip and palate associated transmembrane protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019649.2-3002s1c1
Sequence:CCGGCAAGAAGGACAAGCCCTATTTCTCGAGAAATAGGGCTTGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019649.1-1653s1c1
Sequence:CCGGGCCCTCAACACTTTCATTGATCTCGAGATCAATGAAAGTGTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019649.1-489s1c1
Sequence:CCGGGCAGAATGGCTCCATCTATATCTCGAGATATAGATGGAGCCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019649.1-1658s1c1
Sequence:CCGGCAACACTTTCATTGATGACTTCTCGAGAAGTCATCAATGAAAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019649.1-497s1c1
Sequence:CCGGGCTCCATCTATATCCATGTCTCTCGAGAGACATGGATATAGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019649.1-1584s1c1
Sequence:CCGGCCACAGCTCTTCATCAACTATCTCGAGATAGTTGATGAAGAGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019649.1-1231s1c1
Sequence:CCGGCTCCTTTACATCCTGGACAATCTCGAGATTGTCCAGGATGTAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks