EMAIL THIS PAGE TO A FRIEND

CLPTM1L

CLPTM1-like

53 Gene Product Result for
Synonyms: CRR9
UniProtKB ID: Q96KA5, D3DTC1, Q658W6, Q7LG29, Q96AZ0, Q9H3N4
Gene ID:
Mouse(218335) CLPTM1-like
Rat(316916) CLPTM1-like
Zebrafish(436653) cleft lip and palate associated transmembrane protein 1, like
cow(506200) CLPTM1-like
Horse(100071903) CLPTM1-like
dog(478630) CLPTM1-like
chicken(420973) CLPTM1-like
sheep(101112164) CLPTM1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146047 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146047 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146047 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030782 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030782 Rosetta Predictions human pricing
NM_001108240 Rosetta Predictions rat pricing
NM_146047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206494 predicted 1720
2 SASI_Hs01_00206495 predicted 926
3 SASI_Hs01_00206496 predicted 1194
4 SASI_Hs01_00206497 predicted 1541
5 SASI_Hs01_00206498 predicted 1691
6 SASI_Hs01_00206499 predicted 958
7 SASI_Hs01_00206500 predicted 913
8 SASI_Hs01_00206502 predicted 721
9 SASI_Hs02_00358325 predicted 1397
10 SASI_Hs01_00206503 predicted 334
11 SASI_Hs01_00206501 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236704 predicted 1606
2 SASI_Rn02_00236705 predicted 1453
3 SASI_Rn02_00236706 predicted 1439
4 SASI_Rn02_00236707 predicted 515
5 SASI_Rn02_00236708 predicted 670
6 SASI_Rn02_00236709 predicted 1513
7 SASI_Rn02_00236710 predicted 451
8 SASI_Rn02_00236711 predicted 1396
9 SASI_Rn02_00236712 predicted 1041
10 SASI_Rn02_00236713 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341656 predicted 1645
2 SASI_Mm02_00341657 predicted 789
3 SASI_Mm01_00171381 predicted 884
4 SASI_Mm01_00171382 predicted 784
5 SASI_Mm01_00171383 predicted 855
6 SASI_Mm01_00171385 predicted 1247
7 SASI_Mm01_00171386 predicted 194
8 SASI_Mm01_00171387 predicted 227
9 SASI_Mm01_00171389 predicted 474
10 SASI_Mm01_00171390 predicted 1194
11 SASI_Mm01_00171384 predicted 620
12 SASI_Mm01_00171388 predicted 1142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146047
VALIDATED
CLPTM1L MISSION shRNA Bacterial Glycerol Stock
CLPTM1-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146047.1-1714s1c1
Sequence:CCGGCGTGTTTCAGAAGGAACCATACTCGAGTATGGTTCCTTCTGAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146047.1-1420s1c1
Sequence:CCGGCTGGCCTGTTTCAGAGATGATCTCGAGATCATCTCTGAAACAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146047.1-1701s21c1
Sequence:CCGGCACCCTCTCTTCTCGTGTTTCCTCGAGGAAACACGAGAAGAGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146047.1-1196s21c1
Sequence:CCGGCACTCCTAAATATCAAGTATACTCGAGTATACTTGATATTTAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146047.1-774s21c1
Sequence:CCGGTTTCGTAGACACCAACTTATACTCGAGTATAAGTTGGTGTCTACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146047.1-90s1c1
Sequence:CCGGCAAACTGCAGCTGAGTGTTTACTCGAGTAAACACTCAGCTGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146047.1-241s21c1
Sequence:CCGGGGGACGCTGTATGCATATATTCTCGAGAATATATGCATACAGCGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146047
VALIDATED
CLPTM1L MISSION shRNA shRNA Plasmid DNA
CLPTM1-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146047.1-1714s1c1
Sequence:CCGGCGTGTTTCAGAAGGAACCATACTCGAGTATGGTTCCTTCTGAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146047.1-1420s1c1
Sequence:CCGGCTGGCCTGTTTCAGAGATGATCTCGAGATCATCTCTGAAACAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146047.1-1701s21c1
Sequence:CCGGCACCCTCTCTTCTCGTGTTTCCTCGAGGAAACACGAGAAGAGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146047.1-1196s21c1
Sequence:CCGGCACTCCTAAATATCAAGTATACTCGAGTATACTTGATATTTAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146047.1-774s21c1
Sequence:CCGGTTTCGTAGACACCAACTTATACTCGAGTATAAGTTGGTGTCTACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146047.1-90s1c1
Sequence:CCGGCAAACTGCAGCTGAGTGTTTACTCGAGTAAACACTCAGCTGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146047.1-241s21c1
Sequence:CCGGGGGACGCTGTATGCATATATTCTCGAGAATATATGCATACAGCGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146047
VALIDATED
CLPTM1L MISSION shRNA Lentiviral Transduction Particles
CLPTM1-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146047.1-1714s1c1
Sequence:CCGGCGTGTTTCAGAAGGAACCATACTCGAGTATGGTTCCTTCTGAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146047.1-1420s1c1
Sequence:CCGGCTGGCCTGTTTCAGAGATGATCTCGAGATCATCTCTGAAACAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146047.1-1701s21c1
Sequence:CCGGCACCCTCTCTTCTCGTGTTTCCTCGAGGAAACACGAGAAGAGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146047.1-1196s21c1
Sequence:CCGGCACTCCTAAATATCAAGTATACTCGAGTATACTTGATATTTAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146047.1-774s21c1
Sequence:CCGGTTTCGTAGACACCAACTTATACTCGAGTATAAGTTGGTGTCTACGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146047.1-90s1c1
Sequence:CCGGCAAACTGCAGCTGAGTGTTTACTCGAGTAAACACTCAGCTGCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_146047.1-241s21c1
Sequence:CCGGGGGACGCTGTATGCATATATTCTCGAGAATATATGCATACAGCGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030782
VALIDATED
CLPTM1L MISSION shRNA Bacterial Glycerol Stock
CLPTM1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030782.2-1183s1c1
Sequence:CCGGCCGAATTTCAGTTTGGCACTTCTCGAGAAGTGCCAAACTGAAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030782.2-282s1c1
Sequence:CCGGGACTTTGATGTGGAGTCCAAACTCGAGTTTGGACTCCACATCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_030782.2-1232s1c1
Sequence:CCGGGTACGATACTCAGGCCATGAACTCGAGTTCATGGCCTGAGTATCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030782.2-1683s1c1
Sequence:CCGGCCAGCCAAGTGCAACTTGAATCTCGAGATTCAAGTTGCACTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030782.2-458s1c1
Sequence:CCGGGCCAGAAGAAATCAACCTGCTCTCGAGAGCAGGTTGATTTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030782.2-1850s1c1
Sequence:CCGGCGTGTGAACATCTGTCTTGGTCTCGAGACCAAGACAGATGTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030782.2-1993s1c1
Sequence:CCGGGATTTCCATTTCAGGTGGTTTCTCGAGAAACCACCTGAAATGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_030782.2-931s1c1
Sequence:CCGGCGTTCCATCTTCTCTTTGATTCTCGAGAATCAAAGAGAAGATGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030782.2-974s1c1
Sequence:CCGGCAGTTTCTGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030782
VALIDATED
CLPTM1L MISSION shRNA shRNA Plasmid DNA
CLPTM1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030782.2-1183s1c1
Sequence:CCGGCCGAATTTCAGTTTGGCACTTCTCGAGAAGTGCCAAACTGAAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030782.2-282s1c1
Sequence:CCGGGACTTTGATGTGGAGTCCAAACTCGAGTTTGGACTCCACATCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_030782.2-1232s1c1
Sequence:CCGGGTACGATACTCAGGCCATGAACTCGAGTTCATGGCCTGAGTATCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030782.2-1683s1c1
Sequence:CCGGCCAGCCAAGTGCAACTTGAATCTCGAGATTCAAGTTGCACTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030782.2-458s1c1
Sequence:CCGGGCCAGAAGAAATCAACCTGCTCTCGAGAGCAGGTTGATTTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030782.2-1850s1c1
Sequence:CCGGCGTGTGAACATCTGTCTTGGTCTCGAGACCAAGACAGATGTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030782.2-1993s1c1
Sequence:CCGGGATTTCCATTTCAGGTGGTTTCTCGAGAAACCACCTGAAATGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_030782.2-931s1c1
Sequence:CCGGCGTTCCATCTTCTCTTTGATTCTCGAGAATCAAAGAGAAGATGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030782.2-974s1c1
Sequence:CCGGCAGTTTCTGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030782
VALIDATED
CLPTM1L MISSION shRNA Lentiviral Transduction Particles
CLPTM1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030782.2-1183s1c1
Sequence:CCGGCCGAATTTCAGTTTGGCACTTCTCGAGAAGTGCCAAACTGAAATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030782.2-282s1c1
Sequence:CCGGGACTTTGATGTGGAGTCCAAACTCGAGTTTGGACTCCACATCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_030782.2-1232s1c1
Sequence:CCGGGTACGATACTCAGGCCATGAACTCGAGTTCATGGCCTGAGTATCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030782.2-1683s1c1
Sequence:CCGGCCAGCCAAGTGCAACTTGAATCTCGAGATTCAAGTTGCACTTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030782.2-458s1c1
Sequence:CCGGGCCAGAAGAAATCAACCTGCTCTCGAGAGCAGGTTGATTTCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030782.2-1850s1c1
Sequence:CCGGCGTGTGAACATCTGTCTTGGTCTCGAGACCAAGACAGATGTTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_030782.2-1993s1c1
Sequence:CCGGGATTTCCATTTCAGGTGGTTTCTCGAGAAACCACCTGAAATGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_030782.2-931s1c1
Sequence:CCGGCGTTCCATCTTCTCTTTGATTCTCGAGAATCAAAGAGAAGATGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030782.2-974s1c1
Sequence:CCGGCAGTTTCTGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks