EMAIL THIS PAGE TO A FRIEND

CLPX

caseinolytic mitochondrial matrix peptidase chaperone subunit

90 Gene Product Result for
UniProtKB ID: O76031, A1L428, A8K8F1, B9EGI8, Q9H4D9
Gene ID:
Mouse(270166) caseinolytic peptidase X (E.coli)
Rat(300786) ClpX caseinolytic peptidase X homolog (E. coli)
sheep(101111198) ClpX caseinolytic peptidase X homolog (E. coli)
Domestic Rabbit(100340597) ClpX caseinolytic peptidase X homolog (E. coli)
domestic guinea pig(100715379) ClpX caseinolytic peptidase X homolog (E. coli)
naked mole-rat(101724117) ClpX caseinolytic peptidase X homolog (E. coli)
Thale Cress(835416) CLP protease regulatory subunit X
cow(100138870) ClpX caseinolytic peptidase X homolog (E. coli)
Horse(100053389) ClpX caseinolytic peptidase X homolog (E. coli)
domestic cat(101085043) ClpX caseinolytic peptidase X homolog (E. coli)
dog(609344) ClpX caseinolytic peptidase X homolog (E. coli)
chicken(415527) ClpX caseinolytic peptidase X homolog (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006660 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011802 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011802 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011802 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006660 Rosetta Predictions human pricing
NM_001007803 Rosetta Predictions rat pricing
NM_001044389 Rosetta Predictions mouse pricing
NM_011802 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178496 predicted 1722
2 SASI_Hs01_00178497 predicted 680
3 SASI_Hs02_00342044 predicted 1582
4 SASI_Hs01_00178498 predicted 1284
5 SASI_Hs01_00178499 predicted 1052
6 SASI_Hs01_00178500 predicted 1868
7 SASI_Hs01_00178501 predicted 1523
8 SASI_Hs01_00178502 predicted 330
9 SASI_Hs01_00178503 predicted 405
10 SASI_Hs01_00178504 predicted 1975
11 SASI_Hs01_00178495 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069049 predicted 1053
2 SASI_Rn01_00069050 predicted 344
3 SASI_Rn01_00069051 predicted 645
4 SASI_Rn01_00069052 predicted 574
5 SASI_Rn01_00069053 predicted 1504
6 SASI_Rn01_00069054 predicted 1602
7 SASI_Rn02_00198968 predicted 1163
8 SASI_Rn01_00069056 predicted 611
9 SASI_Rn01_00069057 predicted 980
10 SASI_Rn01_00069058 predicted 1561
11 SASI_Rn01_00069055 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291284 predicted 538
2 SASI_Mm02_00291285 predicted 268
3 SASI_Mm02_00291286 predicted 457
4 SASI_Mm02_00291287 predicted 2136
5 SASI_Mm02_00291288 predicted 373
6 SASI_Mm02_00291289 predicted 285
7 SASI_Mm02_00291290 predicted 1363
8 SASI_Mm02_00291291 predicted 1317
9 SASI_Mm02_00291292 predicted 1576
10 SASI_Mm02_00291293 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093840 predicted 537
2 SASI_Mm02_00321480 predicted 269
3 SASI_Mm02_00321481 predicted 452
4 SASI_Mm01_00093841 predicted 2172
5 SASI_Mm01_00093842 predicted 371
6 SASI_Mm02_00321482 predicted 286
7 SASI_Mm01_00093845 predicted 1410
8 SASI_Mm01_00093846 predicted 1357
9 SASI_Mm02_00321483 predicted 1617
10 SASI_Mm02_00321484 predicted 1177
11 SASI_Mm01_00093838 predicted 1241
12 SASI_Mm01_00093839 predicted 835
13 SASI_Mm01_00093843 predicted 803
14 SASI_Mm01_00093844 predicted 764
15 SASI_Mm01_00093847 predicted 1415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006660
VALIDATED
CLPX MISSION shRNA Bacterial Glycerol Stock
caseinolytic mitochondrial matrix peptidase chaperone subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006660.3-2151s21c1
Sequence:CCGGCGGAAGATGTTATATGGACTTCTCGAGAAGTCCATATAACATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006660.3-1059s21c1
Sequence:CCGGCGAAGATATTGAATCTGTGATCTCGAGATCACAGATTCAATATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006660.3-422s21c1
Sequence:CCGGCCTTTGTATCATCCACCCGTTCTCGAGAACGGGTGGATGATACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006660.3-1795s21c1
Sequence:CCGGCCAATGTTTGAAGTCCCTAATCTCGAGATTAGGGACTTCAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006660.3-2151s1c1
Sequence:CCGGCGGAAGATGTTATATGGACTTCTCGAGAAGTCCATATAACATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006660.3-1795s1c1
Sequence:CCGGCCAATGTTTGAAGTCCCTAATCTCGAGATTAGGGACTTCAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006660.3-422s1c1
Sequence:CCGGCCTTTGTATCATCCACCCGTTCTCGAGAACGGGTGGATGATACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006660.3-1059s1c1
Sequence:CCGGCGAAGATATTGAATCTGTGATCTCGAGATCACAGATTCAATATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006660
VALIDATED
CLPX MISSION shRNA shRNA Plasmid DNA
caseinolytic mitochondrial matrix peptidase chaperone subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006660.3-2151s21c1
Sequence:CCGGCGGAAGATGTTATATGGACTTCTCGAGAAGTCCATATAACATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006660.3-1059s21c1
Sequence:CCGGCGAAGATATTGAATCTGTGATCTCGAGATCACAGATTCAATATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006660.3-422s21c1
Sequence:CCGGCCTTTGTATCATCCACCCGTTCTCGAGAACGGGTGGATGATACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006660.3-1795s21c1
Sequence:CCGGCCAATGTTTGAAGTCCCTAATCTCGAGATTAGGGACTTCAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006660.3-2151s1c1
Sequence:CCGGCGGAAGATGTTATATGGACTTCTCGAGAAGTCCATATAACATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006660.3-1795s1c1
Sequence:CCGGCCAATGTTTGAAGTCCCTAATCTCGAGATTAGGGACTTCAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006660.3-422s1c1
Sequence:CCGGCCTTTGTATCATCCACCCGTTCTCGAGAACGGGTGGATGATACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006660.3-1059s1c1
Sequence:CCGGCGAAGATATTGAATCTGTGATCTCGAGATCACAGATTCAATATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006660
VALIDATED
CLPX MISSION shRNA Lentiviral Transduction Particles
caseinolytic mitochondrial matrix peptidase chaperone subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006660.3-2151s21c1
Sequence:CCGGCGGAAGATGTTATATGGACTTCTCGAGAAGTCCATATAACATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006660.3-1059s21c1
Sequence:CCGGCGAAGATATTGAATCTGTGATCTCGAGATCACAGATTCAATATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006660.3-422s21c1
Sequence:CCGGCCTTTGTATCATCCACCCGTTCTCGAGAACGGGTGGATGATACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006660.3-1795s21c1
Sequence:CCGGCCAATGTTTGAAGTCCCTAATCTCGAGATTAGGGACTTCAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006660.3-2151s1c1
Sequence:CCGGCGGAAGATGTTATATGGACTTCTCGAGAAGTCCATATAACATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006660.3-1795s1c1
Sequence:CCGGCCAATGTTTGAAGTCCCTAATCTCGAGATTAGGGACTTCAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006660.3-422s1c1
Sequence:CCGGCCTTTGTATCATCCACCCGTTCTCGAGAACGGGTGGATGATACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006660.3-1059s1c1
Sequence:CCGGCGAAGATATTGAATCTGTGATCTCGAGATCACAGATTCAATATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011802
CLPX MISSION shRNA Bacterial Glycerol Stock
caseinolytic mitochondrial matrix peptidase chaperone subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-737s1c1
Sequence:CCGGGCTAAGAAAGTGCTTTCAGTTCTCGAGAACTGAAAGCACTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011802.1-2110s1c1
Sequence:CCGGCCCTGTTCTTTAGGGTCATAACTCGAGTTATGACCCTAAAGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-272s1c1
Sequence:CCGGCGCATCCATGTGCCAATGTTACTCGAGTAACATTGGCACATGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-1498s1c1
Sequence:CCGGCGGCTTTGGAACACCATCTAACTCGAGTTAGATGGTGTTCCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-872s1c1
Sequence:CCGGCGGGAGGATGAGTACAGATTTCTCGAGAAATCTGTACTCATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011802
CLPX MISSION shRNA shRNA Plasmid DNA
caseinolytic mitochondrial matrix peptidase chaperone subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-737s1c1
Sequence:CCGGGCTAAGAAAGTGCTTTCAGTTCTCGAGAACTGAAAGCACTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011802.1-2110s1c1
Sequence:CCGGCCCTGTTCTTTAGGGTCATAACTCGAGTTATGACCCTAAAGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-272s1c1
Sequence:CCGGCGCATCCATGTGCCAATGTTACTCGAGTAACATTGGCACATGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-1498s1c1
Sequence:CCGGCGGCTTTGGAACACCATCTAACTCGAGTTAGATGGTGTTCCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-872s1c1
Sequence:CCGGCGGGAGGATGAGTACAGATTTCTCGAGAAATCTGTACTCATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011802
CLPX MISSION shRNA Lentiviral Transduction Particles
caseinolytic mitochondrial matrix peptidase chaperone subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-737s1c1
Sequence:CCGGGCTAAGAAAGTGCTTTCAGTTCTCGAGAACTGAAAGCACTTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011802.1-2110s1c1
Sequence:CCGGCCCTGTTCTTTAGGGTCATAACTCGAGTTATGACCCTAAAGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-272s1c1
Sequence:CCGGCGCATCCATGTGCCAATGTTACTCGAGTAACATTGGCACATGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-1498s1c1
Sequence:CCGGCGGCTTTGGAACACCATCTAACTCGAGTTAGATGGTGTTCCAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011802.1-872s1c1
Sequence:CCGGCGGGAGGATGAGTACAGATTTCTCGAGAAATCTGTACTCATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks